RchiOBHm_Chr2g0113241

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001949
Physical Location & Seq
Reverse (-)
25420076 .. 25421350
1275 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48659

Sequence Viewer

Length: 207 bp
ATGGGTTGGGCTGTAAGAACTGTTGGGATGATTTTGCGTTGGAGAGGACGAGGGAAACGAAGAAGGTTGGGCCATAAGAACCTTTGGAATGATTATGAGGACCCTTATAATATTAGTTATGACTTTCTAAAGATTCAGCCCCATGTAACAGGTCACCAGGTGAAGAAAAACTATGGCATGGGCTGGCTGGAAGAACTATTGGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

8.14

Weight (kDa)

10.08

Isoelectric Point (pI)

63.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 108
AdeI CACNNNGTG 1 cut(s) 160
AjnI CCWGG 1 cut(s) 156
AoxI GGCC 1 cut(s) 70
AspS9I GGNCC 2 cut(s) 70, 100
AsuHPI GGTGA 2 cut(s) 146, 172
AvaII GGWCC 1 cut(s) 100
BciT130I CCWGG 1 cut(s) 158
Bme1390I CCNGG 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 100
BmgT120I GGNCC 2 cut(s) 70, 100
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 158
BseBI CCWGG 1 cut(s) 158
BseGI GGATG 1 cut(s) 33
BshFI GGCC 1 cut(s) 72
BsnI GGCC 1 cut(s) 72
BspANI GGCC 1 cut(s) 72
BspLI GGNNCC 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 158
Bst4CI ACNGT 1 cut(s) 22
BstC8I GCNNGC 1 cut(s) 185
BstEII GGTNACC 1 cut(s) 152
BstF5I GGATG 1 cut(s) 33
BstNI CCWGG 1 cut(s) 158
BstPI GGTNACC 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 156
BsuRI GGCC 1 cut(s) 72
BtsCI GGATG 1 cut(s) 33
Cac8I GCNNGC 1 cut(s) 185
Cfr13I GGNCC 2 cut(s) 70, 100
CsiI ACCWGGT 1 cut(s) 156
CviAII CATG 2 cut(s) 143, 178
CviJI RGCY 5 cut(s) 11, 72, 139, 183, 187
CviKI_1 RGCY 5 cut(s) 11, 72, 139, 183, 187
DraIII CACNNNGTG 1 cut(s) 160
Eco47I GGWCC 1 cut(s) 100
Eco91I GGTNACC 1 cut(s) 152
EcoO109I RGGNCCY 1 cut(s) 100
EcoO65I GGTNACC 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 156
FaeI CATG 2 cut(s) 146, 181
FaiI YATR 7 cut(s) 75, 96, 108, 120, 144, 174, 179
FatI CATG 2 cut(s) 142, 177
FokI GGATG 1 cut(s) 40
HaeIII GGCC 1 cut(s) 72
Hin1II CATG 2 cut(s) 146, 181
HinfI GANTC 1 cut(s) 133
HphI GGTGA 2 cut(s) 146, 172
HpyAV CCTTC 1 cut(s) 57
HpyCH4III ACNGT 1 cut(s) 22
Hsp92II CATG 2 cut(s) 146, 181
LpnPI CCDG 5 cut(s) 135, 143, 169, 170, 173
MabI ACCWGGT 1 cut(s) 156
MaeIII GTNAC 2 cut(s) 145, 152
MboII GAAGA 3 cut(s) 72, 175, 203
MmeI TCCRAC 1 cut(s) 20
MnlI CCTC 3 cut(s) 38, 44, 91
MspR9I CCNGG 1 cut(s) 158
MvaI CCWGG 1 cut(s) 158
NlaIII CATG 2 cut(s) 146, 181
NlaIV GGNNCC 1 cut(s) 102
NmuCI GTSAC 1 cut(s) 152
PcsI WCGNNNNNNNCGW 1 cut(s) 55
PfeI GAWTC 1 cut(s) 133
PpuMI RGGWCCY 1 cut(s) 100
PsiI TTATAA 1 cut(s) 108
Psp5II RGGWCCY 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 156
PspEI GGTNACC 1 cut(s) 152
PspGI CCWGG 1 cut(s) 156
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 2 cut(s) 70, 100
PspPPI RGGWCCY 1 cut(s) 100
Sau96I GGNCC 2 cut(s) 70, 100
ScrFI CCNGG 1 cut(s) 158
SetI ASST 4 cut(s) 68, 84, 154, 162
SexAI ACCWGGT 1 cut(s) 156
SgeI CNNG 8 cut(s) 62, 155, 162, 169, 170, 190, 196, 200
SinI GGWCC 1 cut(s) 100
SspI AATATT 1 cut(s) 112
StyD4I CCNGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 22
TfiI GAWTC 1 cut(s) 133
TseFI GTSAC 1 cut(s) 152
Tsp45I GTSAC 1 cut(s) 152
VpaK11BI GGWCC 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.