RchiOBHm_Chr2g0164311

Inner membrane component of T3SS, cytoplasmic domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
79479327 .. 79479956
630 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53239

Sequence Viewer

Length: 291 bp
ATGTCTGGGGTTTCATCTAAGCTAGTGCTTGATAAAACTGAGCAATTGCAAAAGGAACTCTCAGATCTCCAGTTCGAATATGACAGGGCAGTCTTCCTTTTGAAGATTGCTGATTCAACAGGTGAAGCAGCCAAGAAAAGGGATTCAAAGGTGCTTCCTGAAAATCCTGAAACTTCTGCTGCTGCCATCAAGAAGCAACATCCATTTAAACCAAAGGAAACCTGTCTGCCTGAAAATCCAGAAAGTGGCTATAAAGAAAGAGGAGAGTACAGATGTGACTGTTGCATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.81

Weight (kDa)

5.86

Isoelectric Point (pI)

41.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 89
AccB7I CCANNNNNTGG 1 cut(s) 245
AfaI GTAC 1 cut(s) 269
AfiI CCNNNNNNNGG 2 cut(s) 138, 245
AgsI TTSAA 3 cut(s) 103, 117, 147
AluBI AGCT 1 cut(s) 22
AluI AGCT 1 cut(s) 22
ApeKI GCWGC 3 cut(s) 128, 179, 182
AsuHPI GGTGA 1 cut(s) 134
AsuII TTCGAA 1 cut(s) 75
BbsI GAAGAC 1 cut(s) 85
BbvI GCAGC 3 cut(s) 140, 166, 169
BccI CCATC 1 cut(s) 194
BfaI CTAG 2 cut(s) 23, 289
BglII AGATCT 1 cut(s) 64
BisI GCNGC 3 cut(s) 129, 180, 183
BlsI GCNGC 3 cut(s) 130, 181, 184
BpiI GAAGAC 1 cut(s) 85
BpmI CTGGAG 1 cut(s) 53
Bpu14I TTCGAA 1 cut(s) 75
Bsc4I CCNNNNNNNGG 2 cut(s) 138, 245
Bse1I ACTGG 1 cut(s) 70
BseGI GGATG 1 cut(s) 199
BseLI CCNNNNNNNGG 2 cut(s) 138, 245
BseMII CTCAG 2 cut(s) 30, 75
BseNI ACTGG 1 cut(s) 70
BseRI GAGGAG 1 cut(s) 276
BseXI GCAGC 3 cut(s) 140, 166, 169
BslI CCNNNNNNNGG 2 cut(s) 138, 245
Bsp119I TTCGAA 1 cut(s) 75
Bsp143I GATC 1 cut(s) 64
BspCNI CTCAG 2 cut(s) 31, 74
BspT104I TTCGAA 1 cut(s) 75
BsrI ACTGG 1 cut(s) 70
BssMI GATC 1 cut(s) 64
Bst4CI ACNGT 1 cut(s) 281
BstBI TTCGAA 1 cut(s) 75
BstDEI CTNAG 3 cut(s) 18, 39, 61
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstV1I GCAGC 3 cut(s) 140, 166, 169
BstV2I GAAGAC 1 cut(s) 85
BstX2I RGATCY 1 cut(s) 64
BstYI RGATCY 1 cut(s) 64
BtsCI GGATG 1 cut(s) 199
Csp6I GTAC 1 cut(s) 268
CviJI RGCY 3 cut(s) 22, 131, 249
CviKI_1 RGCY 3 cut(s) 22, 131, 249
CviQI GTAC 1 cut(s) 268
DdeI CTNAG 3 cut(s) 18, 39, 61
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
DraI TTTAAA 1 cut(s) 208
DrdI GACNNNNNNGTC 1 cut(s) 89
DseDI GACNNNNNNGTC 1 cut(s) 89
FaiI YATR 2 cut(s) 81, 252
Fnu4HI GCNGC 3 cut(s) 129, 180, 183
FokI GGATG 1 cut(s) 186
Fsp4HI GCNGC 3 cut(s) 129, 180, 183
FspBI CTAG 2 cut(s) 23, 289
GluI GCNGC 3 cut(s) 129, 180, 183
GsuI CTGGAG 1 cut(s) 53
HinfI GANTC 2 cut(s) 113, 143
HphI GGTGA 1 cut(s) 134
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 4 cut(s) 158, 167, 190, 239
HpyCH4III ACNGT 1 cut(s) 281
HpyCH4V TGCA 2 cut(s) 49, 285
HpyF3I CTNAG 3 cut(s) 18, 39, 61
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 8 cut(s) 70, 83, 105, 171, 180, 235, 243, 252
Lsp1109I GCAGC 3 cut(s) 140, 166, 169
MaeI CTAG 2 cut(s) 23, 289
MaeIII GTNAC 1 cut(s) 275
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 2 cut(s) 85, 115
MfeI CAATTG 1 cut(s) 44
MflI RGATCY 1 cut(s) 64
MluCI AATT 1 cut(s) 44
MnlI CCTC 1 cut(s) 254
MseI TTAA 1 cut(s) 207
MunI CAATTG 1 cut(s) 44
NdeII GATC 1 cut(s) 64
NmuCI GTSAC 1 cut(s) 275
NspV TTCGAA 1 cut(s) 75
PfeI GAWTC 2 cut(s) 113, 143
PflMI CCANNNNNTGG 1 cut(s) 245
PkrI GCNGC 3 cut(s) 130, 181, 184
PsuI RGATCY 1 cut(s) 64
RsaI GTAC 1 cut(s) 269
RsaNI GTAC 1 cut(s) 268
SaqAI TTAA 1 cut(s) 207
SatI GCNGC 3 cut(s) 129, 180, 183
Sau3AI GATC 1 cut(s) 64
SetI ASST 4 cut(s) 24, 124, 153, 224
SfuI TTCGAA 1 cut(s) 75
Sse9I AATT 1 cut(s) 44
SspMI CTAG 2 cut(s) 23, 289
TaaI ACNGT 1 cut(s) 281
TaqI TCGA 1 cut(s) 75
TasI AATT 1 cut(s) 44
TatI WGTACW 1 cut(s) 267
TfiI GAWTC 2 cut(s) 113, 143
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TseFI GTSAC 1 cut(s) 275
TseI GCWGC 3 cut(s) 128, 179, 182
Tsp45I GTSAC 1 cut(s) 275
Van91I CCANNNNNTGG 1 cut(s) 245
XspI CTAG 2 cut(s) 23, 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.