RchiOBHm_Chr3g0465821

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
12454223 .. 12456997
2775 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43194

Sequence Viewer

Length: 126 bp
ATGGAGGCCTCCAAGACCTCCAGTACAACCTTGAGGAATGCTTTTGGTCCTAAATCACTGATATTCACAAGTTTGATCCTTATTTCAATTACAGAGTCACTCAGGTTGCTTCAACAAGAACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

41

Amino Acids

4.54

Weight (kDa)

8.34

Isoelectric Point (pI)

58.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 70
AfaI GTAC 1 cut(s) 25
AgsI TTSAA 2 cut(s) 87, 113
AlwI GGATC 1 cut(s) 70
AoxI GGCC 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 47
AvaII GGWCC 1 cut(s) 47
Bme18I GGWCC 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 47
BpmI CTGGAG 1 cut(s) 4
BpuEI CTTGAG 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 21
BseMII CTCAG 1 cut(s) 115
BseNI ACTGG 1 cut(s) 21
BshFI GGCC 1 cut(s) 8
BsmI GAATGC 1 cut(s) 43
BsnI GGCC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 75
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 114
BspPI GGATC 1 cut(s) 70
BsrI ACTGG 1 cut(s) 21
BssMI GATC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 101
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BsuRI GGCC 1 cut(s) 8
BtsIMutI CAGTG 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 24
CviJI RGCY 1 cut(s) 8
CviKI_1 RGCY 1 cut(s) 8
CviQI GTAC 1 cut(s) 24
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eco147I AGGCCT 1 cut(s) 8
Eco47I GGWCC 1 cut(s) 47
GsuI CTGGAG 1 cut(s) 4
HaeIII GGCC 1 cut(s) 8
HinfI GANTC 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 101
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 2 cut(s) 34, 88
MaeIII GTNAC 1 cut(s) 96
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MluCI AATT 1 cut(s) 87
MlyI GAGTC 1 cut(s) 104
MnlI CCTC 3 cut(s) 19, 27, 28
Mva1269I GAATGC 1 cut(s) 43
NdeII GATC 1 cut(s) 75
NmuCI GTSAC 1 cut(s) 96
PceI AGGCCT 1 cut(s) 8
PctI GAATGC 1 cut(s) 43
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
PspPI GGNCC 1 cut(s) 47
RsaI GTAC 1 cut(s) 25
RsaNI GTAC 1 cut(s) 24
Sau3AI GATC 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 47
SchI GAGTC 1 cut(s) 104
SetI ASST 3 cut(s) 20, 32, 107
SgeI CNNG 5 cut(s) 25, 33, 43, 81, 115
SinI GGWCC 1 cut(s) 47
SmlI CTYRAG 1 cut(s) 31
SmoI CTYRAG 1 cut(s) 31
Sse9I AATT 1 cut(s) 87
SseBI AGGCCT 1 cut(s) 8
StuI AGGCCT 1 cut(s) 8
TasI AATT 1 cut(s) 87
TatI WGTACW 1 cut(s) 23
TscAI CASTG 1 cut(s) 63
TseFI GTSAC 1 cut(s) 96
Tsp45I GTSAC 1 cut(s) 96
TspRI CASTG 1 cut(s) 63
VpaK11BI GGWCC 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.