Rroxscaffold_3G00222320

toxin transport

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
5343845 .. 5357385
13541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00222320.1

Sequence Viewer

Length: 168 bp
ATGGTGGCTCCGACAGAGAAGTCGATGAACTTTGATCGAGTTAAGAATTTGGTTGGGGTTGGCTTTCGAACATTTGAAGATGATGTTTTAAAGAAGGTTGCACGAGTGGGCAGAAGGAAAAACTTGATAGACAAAAGATTAATAGATTTGTTAAATGGTGAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.33

Weight (kDa)

10.11

Isoelectric Point (pI)

23.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 19
AcsI RAATTY 1 cut(s) 46
AgsI TTSAA 1 cut(s) 77
ApoI RAATTY 1 cut(s) 46
AseI ATTAAT 1 cut(s) 140
AsuII TTCGAA 1 cut(s) 67
BauI CACGAG 1 cut(s) 102
BmiI GGNNCC 1 cut(s) 9
Bpu14I TTCGAA 1 cut(s) 67
Bsp119I TTCGAA 1 cut(s) 67
Bsp143I GATC 1 cut(s) 34
BspLI GGNNCC 1 cut(s) 9
BspT104I TTCGAA 1 cut(s) 67
BssMI GATC 1 cut(s) 34
BssSI CACGAG 1 cut(s) 102
Bst2BI CACGAG 1 cut(s) 102
BstBI TTCGAA 1 cut(s) 67
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
CviJI RGCY 2 cut(s) 8, 63
CviKI_1 RGCY 2 cut(s) 8, 63
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
DraI TTTAAA 1 cut(s) 90
DrdI GACNNNNNNGTC 1 cut(s) 19
DseDI GACNNNNNNGTC 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 12
HpyAV CCTTC 2 cut(s) 88, 108
HpyCH4V TGCA 1 cut(s) 101
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 13
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 1 cut(s) 89
MluCI AATT 1 cut(s) 46
MmeI TCCRAC 1 cut(s) 35
MseI TTAA 4 cut(s) 42, 89, 140, 152
NdeII GATC 1 cut(s) 34
NlaIV GGNNCC 1 cut(s) 9
NspV TTCGAA 1 cut(s) 67
PshBI ATTAAT 1 cut(s) 140
PspN4I GGNNCC 1 cut(s) 9
SaqAI TTAA 4 cut(s) 42, 89, 140, 152
Sau3AI GATC 1 cut(s) 34
SetI ASST 1 cut(s) 99
SfuI TTCGAA 1 cut(s) 67
SgeI CNNG 4 cut(s) 50, 114, 116, 136
Sse9I AATT 1 cut(s) 46
TaqI TCGA 3 cut(s) 23, 37, 67
TasI AATT 1 cut(s) 46
Tru1I TTAA 4 cut(s) 42, 89, 140, 152
Tru9I TTAA 4 cut(s) 42, 89, 140, 152
TspDTI ATGAA 1 cut(s) 41
VspI ATTAAT 1 cut(s) 140
XapI RAATTY 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.