Rh2AG378600

dnaJ homolog subfamily C member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
56725923 .. 56727165
1243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG378600.1

Sequence Viewer

Length: 414 bp
ATGAGCACACGCGCGAGGTTAGCTCCGTTGACTATAACCCCACGCACCGCGACTCGTTTCTCACGAGTCGCGTGGGACGACACAGTGAAGCTCTGGACCGTTGACCGTCCCGCCTCCGTCAGCACGTTCAAGGAGCACGCCTACTGCGTCTACTCCGTCGTTTTTGGTGTGAAAAGCTCGGAAGCTCGTTCCAGTCGTCAATGGAGGCCTCCAAGACCTCCAGCGGTTGCTTCAACAAGAACTTTGACTGGTGACCTTTCTAATCCATTGTTGGTTAAACCTCTTCAACCAGTTGTTGCGCCAGTGGCTCCAGTAGCTCAGAAATCTGATGCACCTGATCATCTTAATAATTTAGTTGGCGCTGGGTATCAATCATTTGAGAATGCTATTTTGAAGAAACTTGCACAGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

137

Amino Acids

15.0

Weight (kDa)

10.33

Isoelectric Point (pI)

40.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 150
AccII CGCG 4 cut(s) 12, 14, 50, 71
AciI CCGC 3 cut(s) 48, 111, 224
AgsI TTSAA 4 cut(s) 130, 234, 287, 394
AluBI AGCT 5 cut(s) 23, 91, 177, 185, 317
AluI AGCT 5 cut(s) 23, 91, 177, 185, 317
Alw21I GWGCWC 2 cut(s) 8, 138
AoxI GGCC 1 cut(s) 206
AspLEI GCGC 3 cut(s) 14, 301, 362
AspS9I GGNCC 1 cut(s) 96
AsuHPI GGTGA 1 cut(s) 263
AvaII GGWCC 1 cut(s) 96
BauI CACGAG 1 cut(s) 63
Bbv12I GWGCWC 2 cut(s) 8, 138
BclI TGATCA 1 cut(s) 337
BfoI RGCGCY 1 cut(s) 363
Bme18I GGWCC 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 96
BmiI GGNNCC 1 cut(s) 309
BmsI GCATC 1 cut(s) 319
BplI GAGNNNNNCTC 2 cut(s) 7, 39
BpmI CTGGAG 2 cut(s) 204, 294
Bse1I ACTGG 5 cut(s) 192, 253, 290, 302, 311
BseMII CTCAG 1 cut(s) 332
BseNI ACTGG 5 cut(s) 192, 253, 290, 302, 311
BseYI CCCAGC 1 cut(s) 362
Bsh1236I CGCG 4 cut(s) 12, 14, 50, 71
BshFI GGCC 1 cut(s) 208
BsiHKAI GWGCWC 2 cut(s) 8, 138
BslFI GGGAC 2 cut(s) 89, 93
BsmFI GGGAC 2 cut(s) 89, 93
BsmI GAATGC 1 cut(s) 388
BsnI GGCC 1 cut(s) 208
Bsp1286I GDGCHC 2 cut(s) 8, 138
Bsp143I GATC 1 cut(s) 337
BspACI CCGC 3 cut(s) 48, 111, 224
BspANI GGCC 1 cut(s) 208
BspCNI CTCAG 1 cut(s) 331
BspFNI CGCG 4 cut(s) 12, 14, 50, 71
BspLI GGNNCC 1 cut(s) 309
BsrI ACTGG 5 cut(s) 192, 253, 290, 302, 311
BssMI GATC 1 cut(s) 337
BssSI CACGAG 1 cut(s) 63
Bst2BI CACGAG 1 cut(s) 63
Bst4CI ACNGT 3 cut(s) 85, 100, 107
Bst6I CTCTTC 1 cut(s) 288
BstC8I GCNNGC 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 318
BstEII GGTNACC 1 cut(s) 251
BstFNI CGCG 4 cut(s) 12, 14, 50, 71
BstH2I RGCGCY 1 cut(s) 363
BstHHI GCGC 3 cut(s) 14, 301, 362
BstKTI GATC 1 cut(s) 340
BstMBI GATC 1 cut(s) 337
BstMWI GCNNNNNNNGC 3 cut(s) 20, 305, 314
BstPI GGTNACC 1 cut(s) 251
BstUI CGCG 4 cut(s) 12, 14, 50, 71
BsuRI GGCC 1 cut(s) 208
BtsIMutI CAGTG 2 cut(s) 90, 309
Cac8I GCNNGC 1 cut(s) 138
CfoI GCGC 3 cut(s) 14, 301, 362
Cfr13I GGNCC 1 cut(s) 96
CseI GACGC 1 cut(s) 136
CviJI RGCY 7 cut(s) 23, 91, 177, 185, 208, 308, 317
CviKI_1 RGCY 7 cut(s) 23, 91, 177, 185, 208, 308, 317
DdeI CTNAG 1 cut(s) 318
DpnI GATC 1 cut(s) 339
DpnII GATC 1 cut(s) 337
Eam1104I CTCTTC 1 cut(s) 288
EarI CTCTTC 1 cut(s) 288
Eco147I AGGCCT 1 cut(s) 208
Eco47I GGWCC 1 cut(s) 96
Eco91I GGTNACC 1 cut(s) 251
EcoO65I GGTNACC 1 cut(s) 251
FaiI YATR 1 cut(s) 35
FaqI GGGAC 2 cut(s) 89, 93
FauI CCCGC 1 cut(s) 118
FbaI TGATCA 1 cut(s) 337
FblI GTMKAC 1 cut(s) 150
GlaI GCGC 3 cut(s) 13, 300, 361
GsaI CCCAGC 1 cut(s) 366
GsuI CTGGAG 2 cut(s) 204, 294
HaeII RGCGCY 1 cut(s) 363
HaeIII GGCC 1 cut(s) 208
HgaI GACGC 1 cut(s) 136
HhaI GCGC 3 cut(s) 14, 301, 362
Hin6I GCGC 3 cut(s) 12, 299, 360
HinP1I GCGC 3 cut(s) 12, 299, 360
HincII GTYRAC 2 cut(s) 30, 103
HindII GTYRAC 2 cut(s) 30, 103
HinfI GANTC 2 cut(s) 52, 66
HphI GGTGA 1 cut(s) 263
Hpy166II GTNNAC 3 cut(s) 30, 103, 151
Hpy188I TCNGA 3 cut(s) 181, 321, 328
Hpy188III TCNNGA 2 cut(s) 63, 94
Hpy8I GTNNAC 3 cut(s) 30, 103, 151
Hpy99I CGWCG 1 cut(s) 161
HpyCH4III ACNGT 3 cut(s) 85, 100, 107
HpyCH4IV ACGT 1 cut(s) 125
HpyCH4V TGCA 2 cut(s) 332, 404
HpyF10VI GCNNNNNNNGC 3 cut(s) 20, 305, 314
HpyF3I CTNAG 1 cut(s) 318
HpySE526I ACGT 1 cut(s) 125
HspAI GCGC 3 cut(s) 12, 299, 360
Ksp22I TGATCA 1 cut(s) 337
Kzo9I GATC 1 cut(s) 337
LmnI GCTCC 3 cut(s) 28, 133, 313
LweI GCATC 1 cut(s) 319
MaeII ACGT 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 251
MalI GATC 1 cut(s) 339
MboI GATC 1 cut(s) 337
MboII GAAGA 2 cut(s) 275, 406
MhlI GDGCHC 2 cut(s) 8, 138
MluCI AATT 1 cut(s) 349
MlyI GAGTC 2 cut(s) 46, 75
MnlI CCTC 6 cut(s) 9, 124, 198, 219, 228, 291
MseI TTAA 2 cut(s) 276, 345
MspA1I CMGCKG 1 cut(s) 224
Mva1269I GAATGC 1 cut(s) 388
MvnI CGCG 4 cut(s) 12, 14, 50, 71
MwoI GCNNNNNNNGC 3 cut(s) 20, 305, 314
NdeII GATC 1 cut(s) 337
NlaIV GGNNCC 1 cut(s) 309
NmuCI GTSAC 1 cut(s) 251
PceI AGGCCT 1 cut(s) 208
PcsI WCGNNNNNNNCGW 4 cut(s) 61, 75, 144, 193
PctI GAATGC 1 cut(s) 388
PleI GAGTC 2 cut(s) 46, 74
PpsI GAGTC 2 cut(s) 46, 74
PspEI GGTNACC 1 cut(s) 251
PspFI CCCAGC 1 cut(s) 362
PspN4I GGNNCC 1 cut(s) 309
PspPI GGNCC 1 cut(s) 96
SaqAI TTAA 2 cut(s) 276, 345
Sau3AI GATC 1 cut(s) 337
Sau96I GGNCC 1 cut(s) 96
SchI GAGTC 2 cut(s) 46, 75
SduI GDGCHC 2 cut(s) 8, 138
SfaNI GCATC 1 cut(s) 319
SinI GGWCC 1 cut(s) 96
Sse9I AATT 1 cut(s) 349
SseBI AGGCCT 1 cut(s) 208
SsiI CCGC 3 cut(s) 48, 111, 224
StuI AGGCCT 1 cut(s) 208
TaaI ACNGT 3 cut(s) 85, 100, 107
TaiI ACGT 1 cut(s) 128
TasI AATT 1 cut(s) 349
Tru1I TTAA 2 cut(s) 276, 345
Tru9I TTAA 2 cut(s) 276, 345
TscAI CASTG 2 cut(s) 90, 309
TseFI GTSAC 1 cut(s) 251
Tsp45I GTSAC 1 cut(s) 251
TspGWI ACGGA 3 cut(s) 15, 106, 145
TspRI CASTG 2 cut(s) 90, 309
VpaK11BI GGWCC 1 cut(s) 96
XmiI GTMKAC 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.