Rh5BG482100

dnaJ homolog subfamily C member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
76809916 .. 76823485
13570 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG482100.1

Sequence Viewer

Length: 318 bp
ATGGAGCGCAATACGGAGCTGTTGCAAGGGCATATAGACCACACGTCACGACAAGCCCAAGAGCAACATGAACAGCTCGTGACCTTGATAAATGCCCAAGCTACGCAAACTAAGGTTGCTTCAACAAGAACTATGACTAGTGACCTTTCTAATCCATTGCTGGTTAAACCTCTTCAACTAGTTGCTGCGCCAGTGGTTCCAGTAGCTCAAAAATTTGATGCACCTGATCGTCTTAATAATTTAGTTGGCGCTGAGTATCAATCATTTGAGAATGCTGTTTTGAAGAAACTTGAACAGGCTGCCCAGAAGCAAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.67

Weight (kDa)

6.83

Isoelectric Point (pI)

41.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 212
AflIII ACRYGT 1 cut(s) 42
AgsI TTSAA 4 cut(s) 123, 176, 283, 293
AhdI GACNNNNNGTC 1 cut(s) 43
AhlI ACTAGT 2 cut(s) 137, 178
AjiI CACGTC 1 cut(s) 45
AluBI AGCT 4 cut(s) 19, 76, 101, 206
AluI AGCT 4 cut(s) 19, 76, 101, 206
ApeKI GCWGC 2 cut(s) 185, 299
ApoI RAATTY 1 cut(s) 212
AspLEI GCGC 3 cut(s) 9, 190, 251
BauI CACGAG 1 cut(s) 77
BbvI GCAGC 2 cut(s) 172, 286
BcuI ACTAGT 2 cut(s) 137, 178
BfaI CTAG 2 cut(s) 138, 179
BfoI RGCGCY 1 cut(s) 252
BisI GCNGC 2 cut(s) 186, 300
BlsI GCNGC 2 cut(s) 187, 301
BmeRI GACNNNNNGTC 1 cut(s) 43
BmgBI CACGTC 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 198
BmsI GCATC 1 cut(s) 208
Bse1I ACTGG 2 cut(s) 191, 200
Bse3DI GCAATG 1 cut(s) 155
BseMI GCAATG 1 cut(s) 155
BseMII CTCAG 1 cut(s) 243
BseNI ACTGG 2 cut(s) 191, 200
BseXI GCAGC 2 cut(s) 172, 286
BsmI GAATGC 1 cut(s) 277
Bsp143I GATC 1 cut(s) 226
BspCNI CTCAG 1 cut(s) 244
BspLI GGNNCC 1 cut(s) 198
BsrDI GCAATG 1 cut(s) 155
BsrI ACTGG 2 cut(s) 191, 200
BssMI GATC 1 cut(s) 226
BssSI CACGAG 1 cut(s) 77
Bst2BI CACGAG 1 cut(s) 77
Bst6I CTCTTC 1 cut(s) 177
BstDEI CTNAG 2 cut(s) 111, 252
BstH2I RGCGCY 1 cut(s) 252
BstHHI GCGC 3 cut(s) 9, 190, 251
BstKTI GATC 1 cut(s) 229
BstMBI GATC 1 cut(s) 226
BstV1I GCAGC 2 cut(s) 172, 286
BtrI CACGTC 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 198
CfoI GCGC 3 cut(s) 9, 190, 251
CviAII CATG 1 cut(s) 68
CviJI RGCY 6 cut(s) 19, 56, 76, 101, 206, 299
CviKI_1 RGCY 6 cut(s) 19, 56, 76, 101, 206, 299
DdeI CTNAG 2 cut(s) 111, 252
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
DriI GACNNNNNGTC 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 177
Eam1105I GACNNNNNGTC 1 cut(s) 43
EarI CTCTTC 1 cut(s) 177
FaeI CATG 1 cut(s) 71
FaiI YATR 4 cut(s) 33, 35, 69, 134
FatI CATG 1 cut(s) 67
Fnu4HI GCNGC 2 cut(s) 186, 300
Fsp4HI GCNGC 2 cut(s) 186, 300
FspBI CTAG 2 cut(s) 138, 179
GlaI GCGC 3 cut(s) 8, 189, 250
GluI GCNGC 2 cut(s) 186, 300
HaeII RGCGCY 1 cut(s) 252
HhaI GCGC 3 cut(s) 9, 190, 251
Hin1II CATG 1 cut(s) 71
Hin6I GCGC 3 cut(s) 7, 188, 249
HinP1I GCGC 3 cut(s) 7, 188, 249
Hpy188III TCNNGA 2 cut(s) 48, 79
HpyCH4IV ACGT 1 cut(s) 44
HpyCH4V TGCA 2 cut(s) 25, 221
HpyF3I CTNAG 2 cut(s) 111, 252
HpySE526I ACGT 1 cut(s) 44
Hsp92II CATG 1 cut(s) 71
HspAI GCGC 3 cut(s) 7, 188, 249
Kzo9I GATC 1 cut(s) 226
LmnI GCTCC 2 cut(s) 4, 16
LpnPI CCDG 5 cut(s) 146, 204, 213, 237, 281
Lsp1109I GCAGC 2 cut(s) 172, 286
LweI GCATC 1 cut(s) 208
MaeI CTAG 2 cut(s) 138, 179
MaeII ACGT 1 cut(s) 44
MaeIII GTNAC 3 cut(s) 45, 79, 140
MalI GATC 1 cut(s) 228
MboI GATC 1 cut(s) 226
MboII GAAGA 2 cut(s) 164, 295
MluCI AATT 2 cut(s) 212, 238
MnlI CCTC 1 cut(s) 180
MseI TTAA 2 cut(s) 165, 234
Mva1269I GAATGC 1 cut(s) 277
NdeII GATC 1 cut(s) 226
NlaIII CATG 1 cut(s) 71
NlaIV GGNNCC 1 cut(s) 198
NmuCI GTSAC 3 cut(s) 45, 79, 140
PctI GAATGC 1 cut(s) 277
PkrI GCNGC 2 cut(s) 187, 301
PspN4I GGNNCC 1 cut(s) 198
SaqAI TTAA 2 cut(s) 165, 234
SatI GCNGC 2 cut(s) 186, 300
Sau3AI GATC 1 cut(s) 226
SfaNI GCATC 1 cut(s) 208
SpeI ACTAGT 2 cut(s) 137, 178
Sse9I AATT 2 cut(s) 212, 238
SspMI CTAG 2 cut(s) 138, 179
TaiI ACGT 1 cut(s) 47
TasI AATT 2 cut(s) 212, 238
Tru1I TTAA 2 cut(s) 165, 234
Tru9I TTAA 2 cut(s) 165, 234
TscAI CASTG 1 cut(s) 198
TseFI GTSAC 3 cut(s) 45, 79, 140
TseI GCWGC 2 cut(s) 185, 299
Tsp45I GTSAC 3 cut(s) 45, 79, 140
TspDTI ATGAA 1 cut(s) 84
TspGWI ACGGA 1 cut(s) 29
TspRI CASTG 1 cut(s) 198
XapI RAATTY 1 cut(s) 212
XspI CTAG 2 cut(s) 138, 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.