Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004165.1

Orthogroup ID

OG0003071

Physical Location & Seq

Genomic Coordinates Reverse (-)

167878 .. 168441

Gene Structure 564 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004165.1_g000048.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 564 bp

atgttgacagacttattgtccaagtttggtggagttaaagacctcatccttggttcaggttgtttggctttggttctgatggagaatagagatgcagctgttgctgcaacaggaccgataattggtgatctttccaacccgctgagggtttctctttcaaccagttgcaccaaagatgaaggtgaaggttatacaccaaaaatgttgagagacttattgtccaagtttgggggagttaaagacatcatccttggttcaggttgtatggctttggttctgatggagaatagagatgcagctgttgctgcaacaggagcggtaattggtgatctttacaacctgctgagggtctctctttttcaaccagttgcaccaaagatgaaggtgtctccggcagctgagaagtatgatcaacctgaactagttattaatttggtcgtggttggctttcaaaaatttaaagatgatgttttaaagaaggttgcacaggccaggcagaagcaaaaacttgatagacaaggtgcatacaaagatgctttctgcttcatccttttgaactgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ RRM_1

Protein Analysis

187

Amino Acids

20.11

Weight (kDa)

8.56

Isoelectric Point (pI)

33.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003071)

Species	Orthologous Gene IDs
malus_domestica	MD10G1127700.v1.1
rosa_chinensis	RchiOBHm_Chr1g0316911 RchiOBHm_Chr1g0316961 RchiOBHm_Chr3g0465821 RchiOBHm_Chr5g0002481
rosa_multiflora	Rmu_sc0002398.1_g000020 Rmu_sc0004165.1_g000048 Rmu_sc0006317.1_g000003
rosa_roxburghii	Rroxscaffold_3G00222320 Rroxscaffold_3G00259850
rosa_rugosa	Rorug05G0291900 Rorug05G0455000
rosa_samantha	Rh1AG024500 Rh1AG113500 Rh1CG022800 Rh1DG304100 Rh2AG339700 Rh2AG378600 Rh2BG382800 Rh2CG279300 Rh3AG080500 Rh3BG082300 Rh3BG144500 Rh3CG145900 Rh4AG080000 Rh4CG086100 Rh5AG181300 Rh5AG182500 Rh5AG348500 Rh5AG464400 Rh5BG211500 Rh5BG470500 Rh5BG482100 Rh6AG330100 Rh7AG171000 Rh7AG472300 Rh7CG489500
rosa_wichuraiana	Rw5G022830

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	348
AccBSI	CCGCTC	1 cut(s)	317
AciI	CCGC	2 cut(s)	140, 317
AcsI	RAATTY	1 cut(s)	455
AfiI	CCNNNNNNNGG	4 cut(s)	122, 145, 228, 346
AgsI	TTSAA	4 cut(s)	159, 362, 452, 556
AhdI	GACNNNNNGTC	2 cut(s)	16, 217
AhlI	ACTAGT	1 cut(s)	421
AjnI	CCWGG	1 cut(s)	491
AluBI	AGCT	3 cut(s)	98, 299, 398
AluI	AGCT	3 cut(s)	98, 299, 398
Alw26I	GTCTC	3 cut(s)	204, 355, 393
AoxI	GGCC	1 cut(s)	489
ApeKI	GCWGC	5 cut(s)	95, 104, 296, 305, 395
ApoI	RAATTY	1 cut(s)	455
AseI	ATTAAT	1 cut(s)	429
AspS9I	GGNCC	1 cut(s)	113
AsuHPI	GGTGA	3 cut(s)	137, 194, 338
AvaII	GGWCC	1 cut(s)	113
BbvCI	CCTCAGC	2 cut(s)	143, 344
BbvI	GCAGC	5 cut(s)	91, 107, 292, 308, 407
BccI	CCATC	2 cut(s)	73, 274
BciT130I	CCWGG	1 cut(s)	493
BclI	TGATCA	1 cut(s)	409
BcoDI	GTCTC	3 cut(s)	204, 355, 393
BcuI	ACTAGT	1 cut(s)	421
BfaI	CTAG	1 cut(s)	422
BfuAI	ACCTGC	1 cut(s)	348
BisI	GCNGC	5 cut(s)	96, 105, 297, 306, 396
BlsI	GCNGC	5 cut(s)	97, 106, 298, 307, 397
Bme1390I	CCNGG	1 cut(s)	493
Bme18I	GGWCC	1 cut(s)	113
BmeRI	GACNNNNNGTC	2 cut(s)	16, 217
BmgT120I	GGNCC	1 cut(s)	113
BmrFI	CCNGG	1 cut(s)	493
BmsI	GCATC	3 cut(s)	82, 283, 523
BplI	GAGNNNNNCTC	4 cut(s)	136, 168, 337, 369
Bpu10I	CCTNAGC	2 cut(s)	143, 344
BsaI	GGTCTC	1 cut(s)	355
BsaJI	CCNNGG	2 cut(s)	49, 250
Bsc4I	CCNNNNNNNGG	4 cut(s)	122, 145, 228, 346
Bse1I	ACTGG	2 cut(s)	162, 365
BseBI	CCWGG	1 cut(s)	493
BseDI	CCNNGG	2 cut(s)	49, 250
BseGI	GGATG	3 cut(s)	45, 246, 546
BseLI	CCNNNNNNNGG	4 cut(s)	122, 145, 228, 346
BseMII	CTCAG	3 cut(s)	134, 335, 390
BseNI	ACTGG	2 cut(s)	162, 365
BseXI	GCAGC	5 cut(s)	91, 107, 292, 308, 407
BshFI	GGCC	1 cut(s)	491
BsiSI	CCGG	1 cut(s)	392
BslI	CCNNNNNNNGG	4 cut(s)	122, 145, 228, 346
BsmAI	GTCTC	3 cut(s)	204, 355, 393
BsnI	GGCC	1 cut(s)	491
Bso31I	GGTCTC	1 cut(s)	355
Bsp143I	GATC	3 cut(s)	127, 328, 409
BspACI	CCGC	2 cut(s)	140, 317
BspANI	GGCC	1 cut(s)	491
BspCNI	CTCAG	3 cut(s)	135, 336, 391
BspMI	ACCTGC	1 cut(s)	348
BspTNI	GGTCTC	1 cut(s)	355
BsrBI	CCGCTC	1 cut(s)	317
BsrI	ACTGG	2 cut(s)	162, 365
BssECI	CCNNGG	2 cut(s)	49, 250
BssMI	GATC	3 cut(s)	127, 328, 409
BssT1I	CCWWGG	2 cut(s)	49, 250
Bst2UI	CCWGG	1 cut(s)	493
Bst4CI	ACNGT	1 cut(s)	560
BstAPI	GCANNNNNTGC	2 cut(s)	101, 302
BstDEI	CTNAG	3 cut(s)	143, 344, 399
BstF5I	GGATG	3 cut(s)	45, 246, 546
BstKTI	GATC	3 cut(s)	130, 331, 412
BstMAI	GTCTC	3 cut(s)	204, 355, 393
BstMBI	GATC	3 cut(s)	127, 328, 409
BstMWI	GCNNNNNNNGC	5 cut(s)	101, 104, 302, 305, 314
BstNI	CCWGG	1 cut(s)	493
BstSCI	CCNGG	1 cut(s)	491
BstV1I	GCAGC	5 cut(s)	91, 107, 292, 308, 407
BsuRI	GGCC	1 cut(s)	491
BtsCI	GGATG	3 cut(s)	45, 246, 546
BveI	ACCTGC	1 cut(s)	348
Cfr13I	GGNCC	1 cut(s)	113
CspCI	CAANNNNNGTGG	2 cut(s)	10, 45
CviJI	RGCY	7 cut(s)	68, 98, 269, 299, 398, 447, 491
CviKI_1	RGCY	7 cut(s)	68, 98, 269, 299, 398, 447, 491
DdeI	CTNAG	3 cut(s)	143, 344, 399
DpnI	GATC	3 cut(s)	129, 330, 411
DpnII	GATC	3 cut(s)	127, 328, 409
DraI	TTTAAA	2 cut(s)	460, 474
DriI	GACNNNNNGTC	2 cut(s)	16, 217
Eam1105I	GACNNNNNGTC	2 cut(s)	16, 217
Eco130I	CCWWGG	2 cut(s)	49, 250
Eco31I	GGTCTC	1 cut(s)	355
Eco47I	GGWCC	1 cut(s)	113
EcoRII	CCWGG	1 cut(s)	491
EcoT14I	CCWWGG	2 cut(s)	49, 250
ErhI	CCWWGG	2 cut(s)	49, 250
FaiI	YATR	4 cut(s)	192, 266, 408, 526
FauI	CCCGC	1 cut(s)	147
FbaI	TGATCA	1 cut(s)	409
Fnu4HI	GCNGC	5 cut(s)	96, 105, 297, 306, 396
FokI	GGATG	3 cut(s)	32, 233, 533
Fsp4HI	GCNGC	5 cut(s)	96, 105, 297, 306, 396
FspBI	CTAG	1 cut(s)	422
GluI	GCNGC	5 cut(s)	96, 105, 297, 306, 396
HaeIII	GGCC	1 cut(s)	491
HapII	CCGG	1 cut(s)	392
HincII	GTYRAC	1 cut(s)	6
HindII	GTYRAC	1 cut(s)	6
HpaII	CCGG	1 cut(s)	392
HphI	GGTGA	3 cut(s)	137, 194, 338
Hpy166II	GTNNAC	1 cut(s)	6
Hpy188I	TCNGA	2 cut(s)	78, 279
Hpy8I	GTNNAC	1 cut(s)	6
HpyAV	CCTTC	4 cut(s)	173, 179, 376, 472
HpyCH4III	ACNGT	1 cut(s)	560
HpyCH4V	TGCA	8 cut(s)	95, 107, 168, 296, 308, 371, 485, 524
HpyF10VI	GCNNNNNNNGC	5 cut(s)	101, 104, 302, 305, 314
HpyF3I	CTNAG	3 cut(s)	143, 344, 399
Ksp22I	TGATCA	1 cut(s)	409
Kzo9I	GATC	3 cut(s)	127, 328, 409
LmnI	GCTCC	1 cut(s)	314
Lsp1109I	GCAGC	5 cut(s)	91, 107, 292, 308, 407
LweI	GCATC	3 cut(s)	82, 283, 523
MaeI	CTAG	1 cut(s)	422
MalI	GATC	3 cut(s)	129, 330, 411
MbiI	CCGCTC	1 cut(s)	317
MboI	GATC	3 cut(s)	127, 328, 409
MluCI	AATT	4 cut(s)	120, 321, 430, 455
MmeI	TCCRAC	1 cut(s)	159
MnlI	CCTC	3 cut(s)	53, 138, 339
MseI	TTAA	5 cut(s)	36, 237, 429, 459, 473
MspA1I	CMGCKG	4 cut(s)	98, 142, 299, 398
MspI	CCGG	1 cut(s)	392
MspR9I	CCNGG	1 cut(s)	493
MvaI	CCWGG	1 cut(s)	493
MwoI	GCNNNNNNNGC	5 cut(s)	101, 104, 302, 305, 314
NdeII	GATC	3 cut(s)	127, 328, 409
PkrI	GCNGC	5 cut(s)	97, 106, 298, 307, 397
PshBI	ATTAAT	1 cut(s)	429
Psp6I	CCWGG	1 cut(s)	491
PspGI	CCWGG	1 cut(s)	491
PspPI	GGNCC	1 cut(s)	113
PvuII	CAGCTG	3 cut(s)	98, 299, 398
SaqAI	TTAA	5 cut(s)	36, 237, 429, 459, 473
SatI	GCNGC	5 cut(s)	96, 105, 297, 306, 396
Sau3AI	GATC	3 cut(s)	127, 328, 409
Sau96I	GGNCC	1 cut(s)	113
ScrFI	CCNGG	1 cut(s)	493
SfaNI	GCATC	3 cut(s)	82, 283, 523
SinI	GGWCC	1 cut(s)	113
SpeI	ACTAGT	1 cut(s)	421
Sse9I	AATT	4 cut(s)	120, 321, 430, 455
SsiI	CCGC	2 cut(s)	140, 317
SspMI	CTAG	1 cut(s)	422
StyD4I	CCNGG	1 cut(s)	491
StyI	CCWWGG	2 cut(s)	49, 250
TaaI	ACNGT	1 cut(s)	560
TaqII	GACCGA	1 cut(s)	130
TasI	AATT	4 cut(s)	120, 321, 430, 455
Tru1I	TTAA	5 cut(s)	36, 237, 429, 459, 473
Tru9I	TTAA	5 cut(s)	36, 237, 429, 459, 473
TseI	GCWGC	5 cut(s)	95, 104, 296, 305, 395
TspDTI	ATGAA	3 cut(s)	192, 395, 535
VpaK11BI	GGWCC	1 cut(s)	113
VspI	ATTAAT	1 cut(s)	429
XapI	RAATTY	1 cut(s)	455
XspI	CTAG	1 cut(s)	422

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.