Rh5BG211500

dnaJ homolog subfamily C member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
24542354 .. 24543354
1001 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG211500.1

Sequence Viewer

Length: 198 bp
ATGCTTTCGGTTGCTTCAACAAGAACTTTGACTGGTGACCTTTCTAATCCATTGTTGGTTAAACCTCTTCAACCAGTTGTTGCGCCAGTGGCTCCAGGAGCTCAGAAATCTGATGCACCTGATCGTCTTAATAATTTAGTTGGCGCTGGGTATCAATCATTTGAGAATGCTATTTTGAAGAAACTTGCACAGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

6.78

Weight (kDa)

9.4

Isoelectric Point (pI)

27.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 18, 71, 178
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw21I GWGCWC 1 cut(s) 103
AspLEI GCGC 2 cut(s) 85, 146
AsuHPI GGTGA 1 cut(s) 47
BanII GRGCYC 1 cut(s) 103
Bbv12I GWGCWC 1 cut(s) 103
BciT130I CCWGG 1 cut(s) 96
BfoI RGCGCY 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 96
BmiI GGNNCC 1 cut(s) 93
BmrFI CCNGG 1 cut(s) 96
BmsI GCATC 1 cut(s) 103
BpmI CTGGAG 1 cut(s) 78
Bse1I ACTGG 3 cut(s) 37, 74, 86
BseBI CCWGG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 116
BseNI ACTGG 3 cut(s) 37, 74, 86
BseYI CCCAGC 1 cut(s) 146
BsiHKAI GWGCWC 1 cut(s) 103
BsmI GAATGC 1 cut(s) 172
Bsp1286I GDGCHC 1 cut(s) 103
Bsp143I GATC 1 cut(s) 121
BspCNI CTCAG 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 93
BsrI ACTGG 3 cut(s) 37, 74, 86
BssMI GATC 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 96
Bst6I CTCTTC 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 102
BstEII GGTNACC 1 cut(s) 35
BstH2I RGCGCY 1 cut(s) 147
BstHHI GCGC 2 cut(s) 85, 146
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 2 cut(s) 89, 98
BstNI CCWGG 1 cut(s) 96
BstPI GGTNACC 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 93
CfoI GCGC 2 cut(s) 85, 146
CviJI RGCY 2 cut(s) 92, 101
CviKI_1 RGCY 2 cut(s) 92, 101
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eam1104I CTCTTC 1 cut(s) 72
EarI CTCTTC 1 cut(s) 72
Ecl136II GAGCTC 1 cut(s) 101
Eco24I GRGCYC 1 cut(s) 103
Eco53kI GAGCTC 1 cut(s) 101
Eco91I GGTNACC 1 cut(s) 35
EcoICRI GAGCTC 1 cut(s) 101
EcoO65I GGTNACC 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 94
EcoT38I GRGCYC 1 cut(s) 103
FriOI GRGCYC 1 cut(s) 103
GlaI GCGC 2 cut(s) 84, 145
GsaI CCCAGC 1 cut(s) 150
GsuI CTGGAG 1 cut(s) 78
HaeII RGCGCY 1 cut(s) 147
HhaI GCGC 2 cut(s) 85, 146
Hin6I GCGC 2 cut(s) 83, 144
HinP1I GCGC 2 cut(s) 83, 144
HphI GGTGA 1 cut(s) 47
Hpy188I TCNGA 2 cut(s) 105, 112
HpyCH4V TGCA 2 cut(s) 116, 188
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 98
HpyF3I CTNAG 1 cut(s) 102
HspAI GCGC 2 cut(s) 83, 144
Kzo9I GATC 1 cut(s) 121
LmnI GCTCC 2 cut(s) 97, 98
LpnPI CCDG 8 cut(s) 18, 81, 87, 99, 108, 132, 132, 176
LweI GCATC 1 cut(s) 103
MaeIII GTNAC 1 cut(s) 35
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 2 cut(s) 59, 190
MhlI GDGCHC 1 cut(s) 103
MluCI AATT 1 cut(s) 133
MnlI CCTC 1 cut(s) 75
MseI TTAA 2 cut(s) 60, 129
MspR9I CCNGG 1 cut(s) 96
Mva1269I GAATGC 1 cut(s) 172
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 2 cut(s) 89, 98
NdeII GATC 1 cut(s) 121
NlaIV GGNNCC 1 cut(s) 93
NmuCI GTSAC 1 cut(s) 35
PctI GAATGC 1 cut(s) 172
PfoI TCCNGGA 1 cut(s) 94
Psp124BI GAGCTC 1 cut(s) 103
Psp6I CCWGG 1 cut(s) 94
PspEI GGTNACC 1 cut(s) 35
PspFI CCCAGC 1 cut(s) 146
PspGI CCWGG 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 93
SacI GAGCTC 1 cut(s) 103
SaqAI TTAA 2 cut(s) 60, 129
Sau3AI GATC 1 cut(s) 121
ScrFI CCNGG 1 cut(s) 96
SduI GDGCHC 1 cut(s) 103
SetI ASST 5 cut(s) 42, 67, 103, 121, 195
SfaNI GCATC 1 cut(s) 103
SgeI CNNG 8 cut(s) 33, 45, 86, 98, 107, 108, 131, 159
Sse9I AATT 1 cut(s) 133
SstI GAGCTC 1 cut(s) 103
StyD4I CCNGG 1 cut(s) 94
TasI AATT 1 cut(s) 133
Tru1I TTAA 2 cut(s) 60, 129
Tru9I TTAA 2 cut(s) 60, 129
TscAI CASTG 1 cut(s) 93
TseFI GTSAC 1 cut(s) 35
Tsp45I GTSAC 1 cut(s) 35
TspRI CASTG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.