Rh4CG086100

dnaJ homolog subfamily C member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
15655198 .. 15656585
1388 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG086100.1

Sequence Viewer

Length: 213 bp
ATGCTTTCGGTTGCTTCAACAAGAACCATAACTGGTGACCTTTCTAATCCATTGCTGGTTAAACCTCTTCAACCGGTTGCTGCGCTAGTGGCTCCAGTAGCTCAGAAATCTGATGCACCTGATCGTCTTAATAATTTAGTTGGCGCTGGGTATCAATCATTTGAAAATGCTATTTTGAAGAAACTCGCACAGGCTGCCCAAAAGCAAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.37

Weight (kDa)

9.87

Isoelectric Point (pI)

29.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgeI ACCGGT 1 cut(s) 73
AgsI TTSAA 4 cut(s) 18, 71, 164, 178
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
ApeKI GCWGC 2 cut(s) 80, 194
AsiGI ACCGGT 1 cut(s) 73
AspLEI GCGC 2 cut(s) 85, 146
AsuHPI GGTGA 1 cut(s) 47
BbvI GCAGC 2 cut(s) 67, 181
BfaI CTAG 1 cut(s) 86
BfoI RGCGCY 1 cut(s) 147
BisI GCNGC 2 cut(s) 81, 195
BlsI GCNGC 2 cut(s) 82, 196
BmiI GGNNCC 1 cut(s) 93
BmsI GCATC 1 cut(s) 103
BpmI CTGGAG 1 cut(s) 78
BsaWI WCCGGW 1 cut(s) 73
Bse118I RCCGGY 1 cut(s) 73
Bse1I ACTGG 2 cut(s) 37, 95
Bse3DI GCAATG 1 cut(s) 50
BseMI GCAATG 1 cut(s) 50
BseMII CTCAG 1 cut(s) 116
BseNI ACTGG 2 cut(s) 37, 95
BseXI GCAGC 2 cut(s) 67, 181
BseYI CCCAGC 1 cut(s) 146
BshTI ACCGGT 1 cut(s) 73
BsiSI CCGG 1 cut(s) 74
Bsp143I GATC 1 cut(s) 121
BspCNI CTCAG 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 50
BsrFI RCCGGY 1 cut(s) 73
BsrI ACTGG 2 cut(s) 37, 95
BssAI RCCGGY 1 cut(s) 73
BssMI GATC 1 cut(s) 121
Bst6I CTCTTC 1 cut(s) 72
BstAPI GCANNNNNTGC 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 102
BstEII GGTNACC 1 cut(s) 35
BstH2I RGCGCY 1 cut(s) 147
BstHHI GCGC 2 cut(s) 85, 146
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 3 cut(s) 89, 98, 194
BstPI GGTNACC 1 cut(s) 35
BstV1I GCAGC 2 cut(s) 67, 181
CfoI GCGC 2 cut(s) 85, 146
Cfr10I RCCGGY 1 cut(s) 73
CspAI ACCGGT 1 cut(s) 73
CviJI RGCY 3 cut(s) 92, 101, 194
CviKI_1 RGCY 3 cut(s) 92, 101, 194
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eam1104I CTCTTC 1 cut(s) 72
EarI CTCTTC 1 cut(s) 72
Eco91I GGTNACC 1 cut(s) 35
EcoO65I GGTNACC 1 cut(s) 35
FaiI YATR 1 cut(s) 29
Fnu4HI GCNGC 2 cut(s) 81, 195
Fsp4HI GCNGC 2 cut(s) 81, 195
FspBI CTAG 1 cut(s) 86
GlaI GCGC 2 cut(s) 84, 145
GluI GCNGC 2 cut(s) 81, 195
GsaI CCCAGC 1 cut(s) 150
GsuI CTGGAG 1 cut(s) 78
HaeII RGCGCY 1 cut(s) 147
HapII CCGG 1 cut(s) 74
HhaI GCGC 2 cut(s) 85, 146
Hin6I GCGC 2 cut(s) 83, 144
HinP1I GCGC 2 cut(s) 83, 144
HpaII CCGG 1 cut(s) 74
HphI GGTGA 1 cut(s) 47
Hpy188I TCNGA 2 cut(s) 105, 112
HpyCH4V TGCA 1 cut(s) 116
HpyF10VI GCNNNNNNNGC 3 cut(s) 89, 98, 194
HpyF3I CTNAG 1 cut(s) 102
HspAI GCGC 2 cut(s) 83, 144
Kzo9I GATC 1 cut(s) 121
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 7 cut(s) 18, 41, 87, 108, 132, 132, 176
Lsp1109I GCAGC 2 cut(s) 67, 181
LweI GCATC 1 cut(s) 103
MaeI CTAG 1 cut(s) 86
MaeIII GTNAC 1 cut(s) 35
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 2 cut(s) 59, 190
MluCI AATT 1 cut(s) 133
MnlI CCTC 1 cut(s) 75
MseI TTAA 2 cut(s) 60, 129
MspI CCGG 1 cut(s) 74
MwoI GCNNNNNNNGC 3 cut(s) 89, 98, 194
NdeII GATC 1 cut(s) 121
NlaIV GGNNCC 1 cut(s) 93
NmuCI GTSAC 1 cut(s) 35
PinAI ACCGGT 1 cut(s) 73
PkrI GCNGC 2 cut(s) 82, 196
PspEI GGTNACC 1 cut(s) 35
PspFI CCCAGC 1 cut(s) 146
PspN4I GGNNCC 1 cut(s) 93
SaqAI TTAA 2 cut(s) 60, 129
SatI GCNGC 2 cut(s) 81, 195
Sau3AI GATC 1 cut(s) 121
SetI ASST 4 cut(s) 42, 67, 103, 121
SfaNI GCATC 1 cut(s) 103
Sse9I AATT 1 cut(s) 133
SspMI CTAG 1 cut(s) 86
TasI AATT 1 cut(s) 133
Tru1I TTAA 2 cut(s) 60, 129
Tru9I TTAA 2 cut(s) 60, 129
TseFI GTSAC 1 cut(s) 35
TseI GCWGC 2 cut(s) 80, 194
Tsp45I GTSAC 1 cut(s) 35
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.