Rh7AG472300

dnaJ homolog subfamily C member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
65591134 .. 65591382
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG472300.1

Sequence Viewer

Length: 249 bp
ATGGAGACTAGAGATGCAGCTGTTGCCGCAACAGGAGAGGTAATTGGTGATCTTTCTAATCCGTTGAGGGTTTCGCTTTTTCAACCGGTCGCACCGAAGAGGATGGTGGCTCCGACAGCAGAGAAGTCTGATGAACCTGATCGAGTTAAGAATTTGGTTGGGGTTGGCTTTCGAACATTTGAAGATGATGTTTTAAAGAAGGTTGCACAGGCTGGGCAGAAGGAAAAACTTGATAGACAAAGTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

8.9

Weight (kDa)

6.23

Isoelectric Point (pI)

28.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 27
AcsI RAATTY 1 cut(s) 151
AgeI ACCGGT 1 cut(s) 85
AgsI TTSAA 2 cut(s) 83, 182
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
ApeKI GCWGC 1 cut(s) 17
ApoI RAATTY 1 cut(s) 151
AsiGI ACCGGT 1 cut(s) 85
AsuHPI GGTGA 1 cut(s) 59
AsuII TTCGAA 1 cut(s) 172
BbvI GCAGC 1 cut(s) 29
BccI CCATC 1 cut(s) 97
BfaI CTAG 1 cut(s) 9
BisI GCNGC 2 cut(s) 18, 27
BlsI GCNGC 2 cut(s) 19, 28
BmiI GGNNCC 1 cut(s) 111
BmsI GCATC 1 cut(s) 4
Bpu14I TTCGAA 1 cut(s) 172
BsaWI WCCGGW 1 cut(s) 85
Bse118I RCCGGY 1 cut(s) 85
BseGI GGATG 1 cut(s) 108
BseXI GCAGC 1 cut(s) 29
BseYI CCCAGC 1 cut(s) 212
Bsh1285I CGRYCG 1 cut(s) 90
BshTI ACCGGT 1 cut(s) 85
BsiEI CGRYCG 1 cut(s) 90
BsiSI CCGG 1 cut(s) 86
Bsp119I TTCGAA 1 cut(s) 172
Bsp143I GATC 2 cut(s) 49, 139
BspACI CCGC 1 cut(s) 27
BspLI GGNNCC 1 cut(s) 111
BspT104I TTCGAA 1 cut(s) 172
BsrFI RCCGGY 1 cut(s) 85
BssAI RCCGGY 1 cut(s) 85
BssMI GATC 2 cut(s) 49, 139
Bst6I CTCTTC 1 cut(s) 92
BstAPI GCANNNNNTGC 1 cut(s) 23
BstBI TTCGAA 1 cut(s) 172
BstF5I GGATG 1 cut(s) 108
BstKTI GATC 2 cut(s) 52, 142
BstMBI GATC 2 cut(s) 49, 139
BstMCI CGRYCG 1 cut(s) 90
BstMWI GCNNNNNNNGC 3 cut(s) 23, 26, 116
BstV1I GCAGC 1 cut(s) 29
BtsCI GGATG 1 cut(s) 108
Cfr10I RCCGGY 1 cut(s) 85
CspAI ACCGGT 1 cut(s) 85
CviJI RGCY 4 cut(s) 20, 110, 168, 212
CviKI_1 RGCY 4 cut(s) 20, 110, 168, 212
DpnI GATC 2 cut(s) 51, 141
DpnII GATC 2 cut(s) 49, 139
DraI TTTAAA 1 cut(s) 195
Eam1104I CTCTTC 1 cut(s) 92
EarI CTCTTC 1 cut(s) 92
FaiI YATR 1 cut(s) 247
Fnu4HI GCNGC 2 cut(s) 18, 27
FokI GGATG 1 cut(s) 115
Fsp4HI GCNGC 2 cut(s) 18, 27
FspBI CTAG 1 cut(s) 9
GluI GCNGC 2 cut(s) 18, 27
GsaI CCCAGC 1 cut(s) 216
HapII CCGG 1 cut(s) 86
HpaII CCGG 1 cut(s) 86
HphI GGTGA 1 cut(s) 59
Hpy188I TCNGA 2 cut(s) 114, 130
HpyAV CCTTC 2 cut(s) 193, 214
HpyCH4V TGCA 3 cut(s) 17, 206, 245
HpyF10VI GCNNNNNNNGC 3 cut(s) 23, 26, 116
Kzo9I GATC 2 cut(s) 49, 139
LmnI GCTCC 1 cut(s) 115
LpnPI CCDG 5 cut(s) 18, 99, 150, 194, 198
Lsp1109I GCAGC 1 cut(s) 29
LweI GCATC 1 cut(s) 4
MaeI CTAG 1 cut(s) 9
MalI GATC 2 cut(s) 51, 141
MboI GATC 2 cut(s) 49, 139
MboII GAAGA 2 cut(s) 109, 194
MluCI AATT 2 cut(s) 42, 151
MmeI TCCRAC 1 cut(s) 137
MnlI CCTC 3 cut(s) 31, 60, 93
MseI TTAA 2 cut(s) 147, 194
MspA1I CMGCKG 1 cut(s) 20
MspI CCGG 1 cut(s) 86
MwoI GCNNNNNNNGC 3 cut(s) 23, 26, 116
NdeII GATC 2 cut(s) 49, 139
NlaIV GGNNCC 1 cut(s) 111
NspV TTCGAA 1 cut(s) 172
PinAI ACCGGT 1 cut(s) 85
PkrI GCNGC 2 cut(s) 19, 28
PspFI CCCAGC 1 cut(s) 212
PspN4I GGNNCC 1 cut(s) 111
PvuII CAGCTG 1 cut(s) 20
SaqAI TTAA 2 cut(s) 147, 194
SatI GCNGC 2 cut(s) 18, 27
Sau3AI GATC 2 cut(s) 49, 139
SetI ASST 4 cut(s) 22, 42, 139, 204
SfaNI GCATC 1 cut(s) 4
SfuI TTCGAA 1 cut(s) 172
SgeI CNNG 8 cut(s) 21, 45, 98, 149, 155, 221, 225, 242
Sse9I AATT 2 cut(s) 42, 151
SsiI CCGC 1 cut(s) 27
SspMI CTAG 1 cut(s) 9
TaqI TCGA 2 cut(s) 142, 172
TasI AATT 2 cut(s) 42, 151
TauI GCSGC 1 cut(s) 29
Tru1I TTAA 2 cut(s) 147, 194
Tru9I TTAA 2 cut(s) 147, 194
TseI GCWGC 1 cut(s) 17
TspDTI ATGAA 1 cut(s) 147
TspGWI ACGGA 1 cut(s) 51
XapI RAATTY 1 cut(s) 151
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.