RchiOBHm_Chr4g0398911

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
15839675 .. 15840722
1048 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37107

Sequence Viewer

Length: 144 bp
ATGTTATTTGCACTCGAACCAAATATCAAACATTTTCAGGTTTTCTTGATATTTGGCACTCCAATAAGATCTTTGCTAATGAGTCACTTGAATATTACAAAAATTGTGCAGGCATGGTGTAAAGGTACAGGACATGAAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.38

Weight (kDa)

9.19

Isoelectric Point (pI)

34.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 127
AgsI TTSAA 1 cut(s) 91
BglII AGATCT 1 cut(s) 68
BsgI GTGCAG 1 cut(s) 128
Bsp143I GATC 1 cut(s) 68
BssMI GATC 1 cut(s) 68
BstC8I GCNNGC 1 cut(s) 111
BstKTI GATC 1 cut(s) 71
BstMBI GATC 1 cut(s) 68
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
Cac8I GCNNGC 1 cut(s) 111
Csp6I GTAC 1 cut(s) 126
CviAII CATG 2 cut(s) 114, 134
CviQI GTAC 1 cut(s) 126
DpnI GATC 1 cut(s) 70
DpnII GATC 1 cut(s) 68
FaeI CATG 2 cut(s) 117, 137
FaiI YATR 2 cut(s) 115, 135
FatI CATG 2 cut(s) 113, 133
FspEI CC 8 cut(s) 23, 33, 39, 75, 95, 100, 108, 114
Hin1II CATG 2 cut(s) 117, 137
HinfI GANTC 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 11, 109
Hsp92II CATG 2 cut(s) 117, 137
Kzo9I GATC 1 cut(s) 68
LpnPI CCDG 3 cut(s) 23, 95, 114
MaeIII GTNAC 1 cut(s) 83
MalI GATC 1 cut(s) 70
MboI GATC 1 cut(s) 68
MflI RGATCY 1 cut(s) 68
MluCI AATT 1 cut(s) 102
MlyI GAGTC 1 cut(s) 91
MseI TTAA 1 cut(s) 142
NdeII GATC 1 cut(s) 68
NlaIII CATG 2 cut(s) 117, 137
NmuCI GTSAC 1 cut(s) 83
PleI GAGTC 1 cut(s) 90
PpsI GAGTC 1 cut(s) 90
PsuI RGATCY 1 cut(s) 68
RsaI GTAC 1 cut(s) 127
RsaNI GTAC 1 cut(s) 126
SaqAI TTAA 1 cut(s) 142
Sau3AI GATC 1 cut(s) 68
SchI GAGTC 1 cut(s) 91
SetI ASST 2 cut(s) 42, 127
SgeI CNNG 6 cut(s) 26, 50, 58, 100, 122, 126
Sse9I AATT 1 cut(s) 102
SspI AATATT 1 cut(s) 94
TaqI TCGA 1 cut(s) 15
TasI AATT 1 cut(s) 102
Tru1I TTAA 1 cut(s) 142
Tru9I TTAA 1 cut(s) 142
TseFI GTSAC 1 cut(s) 83
Tsp45I GTSAC 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.