Rh5CG172300

AtCEST,CEST

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
16241846 .. 16244966
3121 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG172300.1

Sequence Viewer

Length: 210 bp
ATGGCCCAATCTGGAGGTTCAGTTAAACCAGCAAAGAGAAAGCCAGGAAAATCACTATATGCAAGAGTCACAGACACTGGTATTGATCTTAAAGAGGCTGCTAAGAGACTGAACATTGATTGGAATACAGCTGCAGAGATTGATGATGCTGATGTTAAGGATGAGTCAGATGTGCATTCAGTTGTGGTTAAGAATCACCATCGCAATTGA

Protein Analysis

69

Amino Acids

7.56

Weight (kDa)

8.07

Isoelectric Point (pI)

36.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 43
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
Alw26I GTCTC 1 cut(s) 100
AlwNI CAGNNNCTG 1 cut(s) 77
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 98, 131
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 188
BbvI GCAGC 2 cut(s) 85, 118
BccI CCATC 1 cut(s) 207
BciT130I CCWGG 1 cut(s) 45
BcoDI GTCTC 1 cut(s) 100
BfmI CTRYAG 1 cut(s) 132
BisI GCNGC 2 cut(s) 99, 132
BlsI GCNGC 2 cut(s) 100, 133
Bme1390I CCNGG 1 cut(s) 45
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 45
BmsI GCATC 1 cut(s) 136
BpmI CTGGAG 1 cut(s) 33
BsaXI ACNNNNNCTCC 2 cut(s) 6, 36
Bse1I ACTGG 1 cut(s) 82
BseBI CCWGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 166
BseNI ACTGG 1 cut(s) 82
BseXI GCAGC 2 cut(s) 85, 118
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 100
BsmI GAATGC 1 cut(s) 175
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 85
BspANI GGCC 1 cut(s) 5
BspMAI CTGCAG 1 cut(s) 136
BsrI ACTGG 1 cut(s) 82
BssMI GATC 1 cut(s) 85
Bst2UI CCWGG 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 102
BstF5I GGATG 1 cut(s) 166
BstKTI GATC 1 cut(s) 88
BstMAI GTCTC 1 cut(s) 100
BstMBI GATC 1 cut(s) 85
BstNI CCWGG 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 2 cut(s) 85, 118
BsuRI GGCC 1 cut(s) 5
BtgZI GCGATG 1 cut(s) 185
BtsCI GGATG 1 cut(s) 166
BtsIMutI CAGTG 1 cut(s) 75
CaiI CAGNNNCTG 1 cut(s) 77
Cfr13I GGNCC 1 cut(s) 4
CviJI RGCY 4 cut(s) 5, 43, 98, 131
CviKI_1 RGCY 4 cut(s) 5, 43, 98, 131
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
EcoRII CCWGG 1 cut(s) 43
FaiI YATR 2 cut(s) 58, 60
Fnu4HI GCNGC 2 cut(s) 99, 132
FokI GGATG 1 cut(s) 173
Fsp4HI GCNGC 2 cut(s) 99, 132
GluI GCNGC 2 cut(s) 99, 132
GsuI CTGGAG 1 cut(s) 33
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 3 cut(s) 66, 164, 193
HphI GGTGA 1 cut(s) 188
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 12
HpyCH4V TGCA 3 cut(s) 62, 134, 175
HpyF3I CTNAG 1 cut(s) 102
Kzo9I GATC 1 cut(s) 85
LpnPI CCDG 4 cut(s) 30, 42, 57, 63
Lsp1109I GCAGC 2 cut(s) 85, 118
LweI GCATC 1 cut(s) 136
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MfeI CAATTG 1 cut(s) 205
MluCI AATT 1 cut(s) 205
MlyI GAGTC 2 cut(s) 75, 173
MnlI CCTC 2 cut(s) 8, 88
MseI TTAA 4 cut(s) 24, 90, 156, 189
MspA1I CMGCKG 1 cut(s) 131
MspR9I CCNGG 1 cut(s) 45
MunI CAATTG 1 cut(s) 205
Mva1269I GAATGC 1 cut(s) 175
MvaI CCWGG 1 cut(s) 45
NdeII GATC 1 cut(s) 85
NmuCI GTSAC 1 cut(s) 67
PctI GAATGC 1 cut(s) 175
PfeI GAWTC 1 cut(s) 193
PkrI GCNGC 2 cut(s) 100, 133
PleI GAGTC 2 cut(s) 74, 172
PpsI GAGTC 2 cut(s) 74, 172
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
PspPI GGNCC 1 cut(s) 4
PstI CTGCAG 1 cut(s) 136
PstNI CAGNNNCTG 1 cut(s) 77
PvuII CAGCTG 1 cut(s) 131
SaqAI TTAA 4 cut(s) 24, 90, 156, 189
SatI GCNGC 2 cut(s) 99, 132
Sau3AI GATC 1 cut(s) 85
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 2 cut(s) 75, 173
ScrFI CCNGG 1 cut(s) 45
SetI ASST 2 cut(s) 19, 133
SfaNI GCATC 1 cut(s) 136
SfcI CTRYAG 1 cut(s) 132
SgeI CNNG 6 cut(s) 24, 41, 56, 57, 75, 90
Sse9I AATT 1 cut(s) 205
StyD4I CCNGG 1 cut(s) 43
TasI AATT 1 cut(s) 205
TfiI GAWTC 1 cut(s) 193
Tru1I TTAA 4 cut(s) 24, 90, 156, 189
Tru9I TTAA 4 cut(s) 24, 90, 156, 189
TscAI CASTG 1 cut(s) 82
TseFI GTSAC 1 cut(s) 67
TseI GCWGC 2 cut(s) 98, 131
Tsp45I GTSAC 1 cut(s) 67
TspRI CASTG 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.