RchiOBHm_Chr5g0003161

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
1915678 .. 1920519
4842 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28448

Sequence Viewer

Length: 180 bp
ATGAAGTTCGGAGGATTGTGTGTGTGTGTGTGTGTGTCTGACATTGATCAACAGGAAAAGAGGCTAGAAGAGGAAGAGGCAGAAGCACAGTTAAATATGGAGCTTACTGAAGAGGTTGCTCATGCTAAAATGGCTAGAAACTTACGCAACAAGATTCATGGTAACTGCATTGATAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.72

Weight (kDa)

5.03

Isoelectric Point (pI)

58.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 129
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
BclI TGATCA 1 cut(s) 46
BfaI CTAG 2 cut(s) 65, 135
Bsp143I GATC 1 cut(s) 46
BssMI GATC 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 90
Bst6I CTCTTC 3 cut(s) 63, 69, 105
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstMWI GCNNNNNNNGC 1 cut(s) 131
CviAII CATG 2 cut(s) 122, 158
CviJI RGCY 3 cut(s) 64, 103, 134
CviKI_1 RGCY 3 cut(s) 64, 103, 134
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eam1104I CTCTTC 3 cut(s) 63, 69, 105
EarI CTCTTC 3 cut(s) 63, 69, 105
Eco57I CTGAAG 1 cut(s) 129
FaeI CATG 2 cut(s) 125, 161
FaiI YATR 3 cut(s) 98, 123, 159
FatI CATG 2 cut(s) 121, 157
FbaI TGATCA 1 cut(s) 46
FspBI CTAG 2 cut(s) 65, 135
FspEI CC 8 cut(s) 38, 46, 56, 62, 83, 98, 116, 144
Hin1II CATG 2 cut(s) 125, 161
HinfI GANTC 1 cut(s) 154
Hpy188I TCNGA 2 cut(s) 11, 40
HpyCH4III ACNGT 1 cut(s) 90
HpyCH4V TGCA 1 cut(s) 168
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
Hsp92II CATG 2 cut(s) 125, 161
Ksp22I TGATCA 1 cut(s) 46
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 1 cut(s) 38
MaeI CTAG 2 cut(s) 65, 135
MaeIII GTNAC 1 cut(s) 161
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 3 cut(s) 80, 86, 122
MnlI CCTC 5 cut(s) 5, 54, 64, 70, 106
MseI TTAA 1 cut(s) 92
MwoI GCNNNNNNNGC 1 cut(s) 131
NdeII GATC 1 cut(s) 46
NlaIII CATG 2 cut(s) 125, 161
PfeI GAWTC 1 cut(s) 154
SaqAI TTAA 1 cut(s) 92
Sau3AI GATC 1 cut(s) 46
SetI ASST 2 cut(s) 105, 117
SgeI CNNG 6 cut(s) 65, 77, 134, 147, 163, 170
SspMI CTAG 2 cut(s) 65, 135
TaaI ACNGT 1 cut(s) 90
TfiI GAWTC 1 cut(s) 154
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TspDTI ATGAA 2 cut(s) 17, 146
XspI CTAG 2 cut(s) 65, 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.