Rh2CG073600

Transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
6057276 .. 6064196
6921 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG073600.1

Sequence Viewer

Length: 294 bp
ATGAATAGCAGGACCAGTCTATCCCAGCGAGAAGATGAAATTCGGAGGATTGAAAAGAGGCTAGAAGAGGAAGAGGCAGAAGCACAGTTAAATATGGAGCTTACTGAAGAGGTTGCTCATGCTAAAATGGCTAGAAACTTACGCAACAAGCTTTATGAGGTTGATATGCATTTGGAAAAACTCCAAGATAATGCAATTCTGTTATACTACTCGAAGCCTTACTCTTCAACCTGTATAGGGGGCGACATCTCTACAGATTCAGTTGCAGACTCATCTGAAGACTTGATTTACTAG

Protein Analysis

97

Amino Acids

11.24

Weight (kDa)

4.63

Isoelectric Point (pI)

79.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 39
AcuI CTGAAG 1 cut(s) 126
AfiI CCNNNNNNNGG 1 cut(s) 237
AgsI TTSAA 2 cut(s) 53, 228
AluBI AGCT 2 cut(s) 100, 151
AluI AGCT 2 cut(s) 100, 151
ApoI RAATTY 1 cut(s) 39
AspS9I GGNCC 1 cut(s) 12
AvaII GGWCC 1 cut(s) 12
BbsI GAAGAC 1 cut(s) 285
BfaI CTAG 3 cut(s) 62, 132, 292
BfmI CTRYAG 1 cut(s) 252
Bme18I GGWCC 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 12
BpiI GAAGAC 1 cut(s) 285
Bsc4I CCNNNNNNNGG 1 cut(s) 237
Bse1I ACTGG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 237
BseNI ACTGG 1 cut(s) 15
BseYI CCCAGC 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 237
BsrI ACTGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 87
Bst6I CTCTTC 4 cut(s) 60, 66, 102, 229
BstMWI GCNNNNNNNGC 1 cut(s) 128
BstSFI CTRYAG 1 cut(s) 252
BstV2I GAAGAC 1 cut(s) 285
Cfr13I GGNCC 1 cut(s) 12
CviAII CATG 1 cut(s) 119
CviJI RGCY 5 cut(s) 61, 100, 131, 151, 217
CviKI_1 RGCY 5 cut(s) 61, 100, 131, 151, 217
Eam1104I CTCTTC 4 cut(s) 60, 66, 102, 229
EarI CTCTTC 4 cut(s) 60, 66, 102, 229
Eco47I GGWCC 1 cut(s) 12
Eco57I CTGAAG 1 cut(s) 126
EcoT22I ATGCAT 1 cut(s) 171
FaeI CATG 1 cut(s) 122
FaiI YATR 6 cut(s) 95, 120, 156, 167, 205, 236
FatI CATG 1 cut(s) 118
FspBI CTAG 3 cut(s) 62, 132, 292
GsaI CCCAGC 1 cut(s) 28
Hin1II CATG 1 cut(s) 122
HindIII AAGCTT 1 cut(s) 149
HinfI GANTC 2 cut(s) 257, 269
Hpy188I TCNGA 2 cut(s) 45, 277
HpyCH4III ACNGT 1 cut(s) 87
HpyCH4V TGCA 3 cut(s) 169, 194, 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 128
Hsp92II CATG 1 cut(s) 122
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 3 cut(s) 28, 38, 244
MaeI CTAG 3 cut(s) 62, 132, 292
MboII GAAGA 6 cut(s) 44, 77, 83, 119, 216, 290
MluCI AATT 2 cut(s) 39, 195
MlyI GAGTC 1 cut(s) 263
MnlI CCTC 6 cut(s) 39, 51, 61, 67, 103, 151
Mph1103I ATGCAT 1 cut(s) 171
MseI TTAA 1 cut(s) 89
MwoI GCNNNNNNNGC 1 cut(s) 128
NlaIII CATG 1 cut(s) 122
NsiI ATGCAT 1 cut(s) 171
PfeI GAWTC 1 cut(s) 257
PleI GAGTC 1 cut(s) 263
PpsI GAGTC 1 cut(s) 263
PspFI CCCAGC 1 cut(s) 24
PspPI GGNCC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 89
Sau96I GGNCC 1 cut(s) 12
SchI GAGTC 1 cut(s) 263
SetI ASST 5 cut(s) 102, 114, 153, 162, 233
SfcI CTRYAG 1 cut(s) 252
SinI GGWCC 1 cut(s) 12
Sse9I AATT 2 cut(s) 39, 195
SspMI CTAG 3 cut(s) 62, 132, 292
TaaI ACNGT 1 cut(s) 87
TaqI TCGA 1 cut(s) 212
TasI AATT 2 cut(s) 39, 195
TfiI GAWTC 1 cut(s) 257
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
TspDTI ATGAA 2 cut(s) 17, 51
VpaK11BI GGWCC 1 cut(s) 12
XapI RAATTY 1 cut(s) 39
XspI CTAG 3 cut(s) 62, 132, 292
Zsp2I ATGCAT 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.