Rh6CG160600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
21041033 .. 21052004
10972 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG160600.1

Sequence Viewer

Length: 240 bp
ATGGTGCAACCCAGGAAGCAGAATTCATATATAAGACATATCCACTCAAGGCTGGCTTTTGGGAATCGATTAAATCTGGTTGAAGCTCTCAAAACCACTTTGGAAGGCTCCCTCCTAATATCAGAGACGAACGAGGCAAGGACAAGGTTGCACCTATGTAATTCATTTTCGGCTTATAAGCTTTTGACTCCGTCGCGGTTGCTTTACATAATAGTTATTTTTCCATTCCCTGTTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.17

Weight (kDa)

10.12

Isoelectric Point (pI)

36.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 177
AccII CGCG 1 cut(s) 196
AciI CCGC 1 cut(s) 196
AcsI RAATTY 1 cut(s) 22
AgsI TTSAA 1 cut(s) 83
AjnI CCWGG 1 cut(s) 11
AluBI AGCT 2 cut(s) 86, 181
AluI AGCT 2 cut(s) 86, 181
Alw26I GTCTC 1 cut(s) 119
ApoI RAATTY 1 cut(s) 22
BciT130I CCWGG 1 cut(s) 13
BcoDI GTCTC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 13
BmiI GGNNCC 1 cut(s) 109
BmrFI CCNGG 1 cut(s) 13
BpuEI CTTGAG 1 cut(s) 31
Bsa29I ATCGAT 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 11
BseBI CCWGG 1 cut(s) 13
BseCI ATCGAT 1 cut(s) 67
BseDI CCNNGG 1 cut(s) 11
Bsh1236I CGCG 1 cut(s) 196
BshVI ATCGAT 1 cut(s) 67
BsmAI GTCTC 1 cut(s) 119
BsmBI CGTCTC 1 cut(s) 119
BspACI CCGC 1 cut(s) 196
BspDI ATCGAT 1 cut(s) 67
BspFNI CGCG 1 cut(s) 196
BspLI GGNNCC 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 11
Bst2UI CCWGG 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 54
BstFNI CGCG 1 cut(s) 196
BstMAI GTCTC 1 cut(s) 119
BstNI CCWGG 1 cut(s) 13
BstSCI CCNGG 1 cut(s) 11
BstUI CGCG 1 cut(s) 196
Bsu15I ATCGAT 1 cut(s) 67
BsuTUI ATCGAT 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 54
ClaI ATCGAT 1 cut(s) 67
CviJI RGCY 6 cut(s) 52, 56, 86, 108, 173, 181
CviKI_1 RGCY 6 cut(s) 52, 56, 86, 108, 173, 181
EcoRI GAATTC 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 11
Esp3I CGTCTC 1 cut(s) 119
FaiI YATR 7 cut(s) 28, 30, 32, 39, 157, 177, 209
FalI AAGNNNNNCTT 2 cut(s) 40, 72
HindIII AAGCTT 1 cut(s) 179
HinfI GANTC 2 cut(s) 64, 187
Hpy188I TCNGA 1 cut(s) 124
Hpy99I CGWCG 1 cut(s) 196
HpyAV CCTTC 1 cut(s) 98
HpyCH4V TGCA 2 cut(s) 7, 151
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 3 cut(s) 25, 38, 62
MluCI AATT 2 cut(s) 22, 160
MlyI GAGTC 1 cut(s) 181
MnlI CCTC 2 cut(s) 122, 127
MseI TTAA 1 cut(s) 71
MspR9I CCNGG 1 cut(s) 13
MvaI CCWGG 1 cut(s) 13
MvnI CGCG 1 cut(s) 196
NlaIV GGNNCC 1 cut(s) 109
PfeI GAWTC 1 cut(s) 64
PflFI GACNNNGTC 1 cut(s) 190
PleI GAGTC 1 cut(s) 181
PpsI GAGTC 1 cut(s) 181
PsiI TTATAA 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 11
PspGI CCWGG 1 cut(s) 11
PspN4I GGNNCC 1 cut(s) 109
PsyI GACNNNGTC 1 cut(s) 190
SaqAI TTAA 1 cut(s) 71
SchI GAGTC 1 cut(s) 181
ScrFI CCNGG 1 cut(s) 13
SetI ASST 4 cut(s) 88, 149, 156, 183
SgeI CNNG 9 cut(s) 24, 25, 60, 65, 89, 145, 150, 156, 207
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
Sse9I AATT 2 cut(s) 22, 160
SsiI CCGC 1 cut(s) 196
StyD4I CCNGG 1 cut(s) 11
TaqI TCGA 1 cut(s) 67
TasI AATT 2 cut(s) 22, 160
TfiI GAWTC 1 cut(s) 64
Tru1I TTAA 1 cut(s) 71
Tru9I TTAA 1 cut(s) 71
TspDTI ATGAA 2 cut(s) 15, 153
TspGWI ACGGA 1 cut(s) 180
Tth111I GACNNNGTC 1 cut(s) 190
XapI RAATTY 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.