Rw2G052200

Cell division cycle and apoptosis regulator protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Reverse (-)
80013363 .. 80019027
5665 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G052200.1

Sequence Viewer

Length: 327 bp
ATGAAAGTCATCCATCCAGTTAATACCATTCCCCAGGTGATTAGGGACATCTGCCAGAGTGCAAAGCAGATGAAGTATGTCACCTCTGAAAATGTGCTTGAATCGCCACTCATAAGCATGGAGATTTTTGGCATGGCAACTGCAAAAAGAAGACATGACATGATTTTGAATGATGGAGGTGAGAGGAATCAAGTCGGCCACATTAGGGTTGAAGATATGAGATTGATAATCCATAACTTGGGAAATTTTCTCTCACACAAGGATGTCAAGAGTCACGCTAATATAATCCATTGGTTGCTGAAATTTGACAGTCGATCCTACATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.49

Weight (kDa)

9.25

Isoelectric Point (pI)

60.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 238
AclWI GGATC 1 cut(s) 309
AcoI YGGCCR 1 cut(s) 196
AcsI RAATTY 2 cut(s) 244, 302
AfiI CCNNNNNNNGG 2 cut(s) 205, 238
AgsI TTSAA 3 cut(s) 101, 169, 212
AjnI CCWGG 1 cut(s) 33
AlwI GGATC 1 cut(s) 309
AoxI GGCC 1 cut(s) 196
ApoI RAATTY 2 cut(s) 244, 302
AsuHPI GGTGA 3 cut(s) 49, 73, 191
BbsI GAAGAC 1 cut(s) 157
BccI CCATC 2 cut(s) 21, 167
BciT130I CCWGG 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 35
BpiI GAAGAC 1 cut(s) 157
BsaJI CCNNGG 1 cut(s) 33
Bsc4I CCNNNNNNNGG 2 cut(s) 205, 238
Bse1I ACTGG 1 cut(s) 17
BseBI CCWGG 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 33
BseGI GGATG 3 cut(s) 9, 13, 268
BseLI CCNNNNNNNGG 2 cut(s) 205, 238
BseNI ACTGG 1 cut(s) 17
BshFI GGCC 1 cut(s) 198
BslFI GGGAC 1 cut(s) 59
BslI CCNNNNNNNGG 2 cut(s) 205, 238
BsmFI GGGAC 1 cut(s) 59
BsnI GGCC 1 cut(s) 198
Bsp143I GATC 1 cut(s) 314
BspANI GGCC 1 cut(s) 198
BspPI GGATC 1 cut(s) 309
BsrI ACTGG 1 cut(s) 17
BssECI CCNNGG 1 cut(s) 33
BssMI GATC 1 cut(s) 314
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 311
BstF5I GGATG 3 cut(s) 9, 13, 268
BstKTI GATC 1 cut(s) 317
BstMBI GATC 1 cut(s) 314
BstMWI GCNNNNNNNGC 1 cut(s) 103
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
BstV2I GAAGAC 1 cut(s) 157
BsuRI GGCC 1 cut(s) 198
BtsCI GGATG 3 cut(s) 9, 13, 268
CviAII CATG 4 cut(s) 118, 133, 155, 160
CviJI RGCY 1 cut(s) 198
CviKI_1 RGCY 1 cut(s) 198
DpnI GATC 1 cut(s) 316
DpnII GATC 1 cut(s) 314
EaeI YGGCCR 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 33
FaeI CATG 4 cut(s) 121, 136, 158, 163
FaiI YATR 9 cut(s) 78, 113, 119, 134, 156, 161, 218, 234, 284
FaqI GGGAC 1 cut(s) 59
FatI CATG 4 cut(s) 117, 132, 154, 159
FokI GGATG 1 cut(s) 275
HaeIII GGCC 1 cut(s) 198
Hin1II CATG 4 cut(s) 121, 136, 158, 163
HinfI GANTC 3 cut(s) 101, 187, 271
HphI GGTGA 3 cut(s) 49, 73, 191
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 268
HpyCH4III ACNGT 1 cut(s) 311
HpyCH4V TGCA 2 cut(s) 62, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 103
Hsp92II CATG 4 cut(s) 121, 136, 158, 163
Kzo9I GATC 1 cut(s) 314
LpnPI CCDG 4 cut(s) 20, 30, 47, 68
MaeIII GTNAC 2 cut(s) 79, 272
MalI GATC 1 cut(s) 316
MboI GATC 1 cut(s) 314
MboII GAAGA 2 cut(s) 162, 224
MluCI AATT 2 cut(s) 244, 302
MlyI GAGTC 1 cut(s) 280
MnlI CCTC 3 cut(s) 94, 170, 177
MseI TTAA 1 cut(s) 21
MslI CAYNNNNRTG 2 cut(s) 116, 261
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
MwoI GCNNNNNNNGC 1 cut(s) 103
NdeII GATC 1 cut(s) 314
NlaIII CATG 4 cut(s) 121, 136, 158, 163
NmuCI GTSAC 2 cut(s) 79, 272
PfeI GAWTC 2 cut(s) 101, 187
PflMI CCANNNNNTGG 1 cut(s) 238
PleI GAGTC 1 cut(s) 279
PpsI GAGTC 1 cut(s) 279
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
RseI CAYNNNNRTG 2 cut(s) 116, 261
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 1 cut(s) 314
SchI GAGTC 1 cut(s) 280
ScrFI CCNGG 1 cut(s) 35
SetI ASST 3 cut(s) 39, 86, 181
SmiMI CAYNNNNRTG 2 cut(s) 116, 261
Sse9I AATT 2 cut(s) 244, 302
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 311
TaqI TCGA 1 cut(s) 313
TasI AATT 2 cut(s) 244, 302
TfiI GAWTC 2 cut(s) 101, 187
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TseFI GTSAC 2 cut(s) 79, 272
Tsp45I GTSAC 2 cut(s) 79, 272
TspDTI ATGAA 2 cut(s) 17, 86
Van91I CCANNNNNTGG 1 cut(s) 238
XapI RAATTY 2 cut(s) 244, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.