Rroxscaffold_2G00154310

Transcription factor

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
90948532 .. 90950352
1821 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00154310.1

Sequence Viewer

Length: 156 bp
ATGAAATTCGGAGGATTGTGTGCGTTTGACATTGATCAACAGGAAAAGAGGCTAGAAGAGGAAGAGGCAGAAGCACAGTTAAATATGGAGCTTACTGAAGAGGTTGCTCATGCTAAAATGGCTAGAAACTTACGCAACAAGGTCCATGTGAAATAA

Protein Analysis

51

Amino Acids

5.93

Weight (kDa)

5.26

Isoelectric Point (pI)

76.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 5
AcuI CTGAAG 1 cut(s) 117
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
ApoI RAATTY 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 142
AvaII GGWCC 1 cut(s) 142
BclI TGATCA 1 cut(s) 34
BfaI CTAG 2 cut(s) 53, 123
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
Bsp143I GATC 1 cut(s) 34
BssMI GATC 1 cut(s) 34
Bst4CI ACNGT 1 cut(s) 78
Bst6I CTCTTC 3 cut(s) 51, 57, 93
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 119
Cfr13I GGNCC 1 cut(s) 142
CviAII CATG 2 cut(s) 110, 146
CviJI RGCY 3 cut(s) 52, 91, 122
CviKI_1 RGCY 3 cut(s) 52, 91, 122
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eam1104I CTCTTC 3 cut(s) 51, 57, 93
EarI CTCTTC 3 cut(s) 51, 57, 93
Eco47I GGWCC 1 cut(s) 142
Eco57I CTGAAG 1 cut(s) 117
FaeI CATG 2 cut(s) 113, 149
FaiI YATR 3 cut(s) 86, 111, 147
FatI CATG 2 cut(s) 109, 145
FbaI TGATCA 1 cut(s) 34
FspBI CTAG 2 cut(s) 53, 123
FspEI CC 8 cut(s) 26, 34, 44, 50, 71, 86, 104, 125
Hin1II CATG 2 cut(s) 113, 149
Hpy188I TCNGA 1 cut(s) 11
HpyCH4III ACNGT 1 cut(s) 78
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
Hsp92II CATG 2 cut(s) 113, 149
Ksp22I TGATCA 1 cut(s) 34
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 1 cut(s) 26
MaeI CTAG 2 cut(s) 53, 123
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 3 cut(s) 68, 74, 110
MluCI AATT 1 cut(s) 5
MnlI CCTC 5 cut(s) 5, 42, 52, 58, 94
MseI TTAA 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 119
NdeII GATC 1 cut(s) 34
NlaIII CATG 2 cut(s) 113, 149
PspPI GGNCC 1 cut(s) 142
SaqAI TTAA 1 cut(s) 80
Sau3AI GATC 1 cut(s) 34
Sau96I GGNCC 1 cut(s) 142
SetI ASST 3 cut(s) 93, 105, 144
SgeI CNNG 5 cut(s) 53, 65, 122, 135, 151
SinI GGWCC 1 cut(s) 142
Sse9I AATT 1 cut(s) 5
SspMI CTAG 2 cut(s) 53, 123
TaaI ACNGT 1 cut(s) 78
TasI AATT 1 cut(s) 5
Tru1I TTAA 1 cut(s) 80
Tru9I TTAA 1 cut(s) 80
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 142
XapI RAATTY 1 cut(s) 5
XspI CTAG 2 cut(s) 53, 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.