Rroxscaffold_6G00387980

Cell division cycle and apoptosis regulator protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
408077 .. 411878
3802 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00387980.1

Sequence Viewer

Length: 234 bp
ATGGTTGAAGATATGAGATTGATAATCCATAACTTGGGAAAGTTCTTCTCACATAGGGATGTCGACGCTCTGCTTTACCTTTTCAGTAGTTCCAAAAACCAAATTATTTTACCACTCTCAGAACCAAATTATTTTCTGCGGATTACAGAAAGGTTTTGCATATTACTGGTGGAGGTCAATTTCTGTGTTTTTTGGCAGTCAGCTCAATTCTCAGCTCATCAAAGCAGTTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

9.04

Weight (kDa)

6.24

Isoelectric Point (pI)

45.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 34
AccI GTMKAC 1 cut(s) 63
AciI CCGC 1 cut(s) 139
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 1 cut(s) 8
AluBI AGCT 2 cut(s) 203, 215
AluI AGCT 2 cut(s) 203, 215
Bsc4I CCNNNNNNNGG 1 cut(s) 34
Bse1I ACTGG 1 cut(s) 171
BseGI GGATG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 34
BseMII CTCAG 2 cut(s) 132, 225
BseNI ACTGG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 34
BspACI CCGC 1 cut(s) 139
BspCNI CTCAG 2 cut(s) 131, 224
BsrI ACTGG 1 cut(s) 171
BstDEI CTNAG 2 cut(s) 118, 211
BstF5I GGATG 1 cut(s) 64
BtsCI GGATG 1 cut(s) 64
CseI GACGC 1 cut(s) 74
CviJI RGCY 2 cut(s) 203, 215
CviKI_1 RGCY 2 cut(s) 203, 215
DdeI CTNAG 2 cut(s) 118, 211
FaiI YATR 5 cut(s) 14, 30, 54, 161, 232
FblI GTMKAC 1 cut(s) 63
FokI GGATG 1 cut(s) 71
HgaI GACGC 1 cut(s) 74
HincII GTYRAC 1 cut(s) 64
HindII GTYRAC 1 cut(s) 64
Hpy166II GTNNAC 1 cut(s) 64
Hpy188I TCNGA 1 cut(s) 121
Hpy8I GTNNAC 1 cut(s) 64
Hpy99I CGWCG 1 cut(s) 68
HpyCH4V TGCA 1 cut(s) 159
HpyF3I CTNAG 2 cut(s) 118, 211
LpnPI CCDG 1 cut(s) 152
MboII GAAGA 2 cut(s) 20, 37
MluCI AATT 4 cut(s) 102, 127, 178, 206
MnlI CCTC 1 cut(s) 166
MslI CAYNNNNRTG 1 cut(s) 57
PflMI CCANNNNNTGG 1 cut(s) 34
RseI CAYNNNNRTG 1 cut(s) 57
SalI GTCGAC 1 cut(s) 62
SetI ASST 5 cut(s) 81, 155, 177, 205, 217
SgeI CNNG 2 cut(s) 46, 179
SmiMI CAYNNNNRTG 1 cut(s) 57
Sse9I AATT 4 cut(s) 102, 127, 178, 206
SsiI CCGC 1 cut(s) 139
TaqI TCGA 1 cut(s) 63
TasI AATT 4 cut(s) 102, 127, 178, 206
TspDTI ATGAA 1 cut(s) 219
Van91I CCANNNNNTGG 1 cut(s) 34
XmiI GTMKAC 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.