RchiOBHm_Chr6g0279321

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0004249
Physical Location & Seq
Forward (+)
42488037 .. 42491763
3727 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25049

Sequence Viewer

Length: 135 bp
ATGATGGATGAGTTCGTGTACCGGTTTCAGAGCTTCTGTCAGTTTAGGGCTAAGATGAAGAACAAGACTGAGCAGGAGATTACTTTTCTCAGGGAGTTTGATCAAGTCTTGGAAGGAGGGAAATATTTCAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Paf67

Protein Analysis

44

Amino Acids

5.45

Weight (kDa)

6.13

Isoelectric Point (pI)

49.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Paf67 PF10255 1 - 36 7.4e-10 RNA polymerase I-associated factor PAF67
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 20
AgeI ACCGGT 1 cut(s) 21
AluBI AGCT 2 cut(s) 33, 132
AluI AGCT 2 cut(s) 33, 132
AsiGI ACCGGT 1 cut(s) 21
Asp700I GAANNNNTTC 1 cut(s) 125
BclI TGATCA 1 cut(s) 100
BsaWI WCCGGW 1 cut(s) 21
Bse118I RCCGGY 1 cut(s) 21
BseGI GGATG 1 cut(s) 13
BseMII CTCAG 2 cut(s) 60, 103
BshTI ACCGGT 1 cut(s) 21
BsiSI CCGG 1 cut(s) 22
Bsp143I GATC 1 cut(s) 100
BspCNI CTCAG 2 cut(s) 61, 102
BsrFI RCCGGY 1 cut(s) 21
BssAI RCCGGY 1 cut(s) 21
BssMI GATC 1 cut(s) 100
BstDEI CTNAG 3 cut(s) 51, 69, 89
BstF5I GGATG 1 cut(s) 13
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 13
Cfr10I RCCGGY 1 cut(s) 21
Csp6I GTAC 1 cut(s) 19
CspAI ACCGGT 1 cut(s) 21
CviJI RGCY 3 cut(s) 33, 50, 132
CviKI_1 RGCY 3 cut(s) 33, 50, 132
CviQI GTAC 1 cut(s) 19
DdeI CTNAG 3 cut(s) 51, 69, 89
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
FbaI TGATCA 1 cut(s) 100
FokI GGATG 1 cut(s) 20
HapII CCGG 1 cut(s) 22
HpaII CCGG 1 cut(s) 22
Hpy166II GTNNAC 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 30
Hpy8I GTNNAC 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 107
HpyF3I CTNAG 3 cut(s) 51, 69, 89
Ksp22I TGATCA 1 cut(s) 100
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 3 cut(s) 35, 59, 76
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MboII GAAGA 1 cut(s) 70
MnlI CCTC 1 cut(s) 110
MroXI GAANNNNTTC 1 cut(s) 125
MspI CCGG 1 cut(s) 22
NdeII GATC 1 cut(s) 100
PdmI GAANNNNTTC 1 cut(s) 125
PinAI ACCGGT 1 cut(s) 21
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
Sau3AI GATC 1 cut(s) 100
SetI ASST 2 cut(s) 35, 134
SgeI CNNG 7 cut(s) 28, 34, 76, 86, 103, 116, 121
SspI AATATT 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 71
XmnI GAANNNNTTC 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.