RchiOBHm_Chr5g0031791

Coatomer subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
25485189 .. 25485718
530 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31100

Sequence Viewer

Length: 192 bp
ATGTTCGAGTGCAACGTTGTTATATATAAGTTTGTGCAGGAACTTCACTTCTTTGTGACTGGAGGTGACGATGAAAATGAACACATTTTAGCAACTCTACTGCAGGGATTCTTTGATGCAGTTGCCCTTCTCTTGAGGAACAATGTCGACAAAAGGGAGGCATTAGAGCATCTGGATCTCATACTCCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.29

Weight (kDa)

4.52

Isoelectric Point (pI)

41.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 147
AclI AACGTT 1 cut(s) 15
AclWI GGATC 1 cut(s) 183
AlwI GGATC 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 77
BfmI CTRYAG 2 cut(s) 101, 188
BmsI GCATC 2 cut(s) 106, 178
BpmI CTGGAG 1 cut(s) 81
BpuEI CTTGAG 1 cut(s) 154
Bse1I ACTGG 1 cut(s) 64
BseNI ACTGG 1 cut(s) 64
BsgI GTGCAG 1 cut(s) 56
Bsp143I GATC 1 cut(s) 175
BspMAI CTGCAG 1 cut(s) 105
BspPI GGATC 1 cut(s) 183
BsrI ACTGG 1 cut(s) 64
BssMI GATC 1 cut(s) 175
BstKTI GATC 1 cut(s) 178
BstMBI GATC 1 cut(s) 175
BstSFI CTRYAG 2 cut(s) 101, 188
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
FaiI YATR 5 cut(s) 23, 25, 27, 182, 190
FblI GTMKAC 1 cut(s) 147
GsuI CTGGAG 1 cut(s) 81
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HinfI GANTC 1 cut(s) 108
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 148
Hpy188III TCNNGA 2 cut(s) 133, 173
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 1 cut(s) 137
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 4 cut(s) 12, 37, 103, 119
HpySE526I ACGT 1 cut(s) 15
Kzo9I GATC 1 cut(s) 175
LpnPI CCDG 4 cut(s) 23, 45, 89, 158
LweI GCATC 2 cut(s) 106, 178
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 55, 65
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MflI RGATCY 1 cut(s) 175
MnlI CCTC 3 cut(s) 56, 129, 151
NdeII GATC 1 cut(s) 175
NmuCI GTSAC 2 cut(s) 55, 65
PcsI WCGNNNNNNNCGW 1 cut(s) 12
PfeI GAWTC 1 cut(s) 108
Psp1406I AACGTT 1 cut(s) 15
PstI CTGCAG 1 cut(s) 105
PsuI RGATCY 1 cut(s) 175
SalI GTCGAC 1 cut(s) 146
Sau3AI GATC 1 cut(s) 175
SetI ASST 2 cut(s) 18, 67
SfaNI GCATC 2 cut(s) 106, 178
SfcI CTRYAG 2 cut(s) 101, 188
SgeI CNNG 6 cut(s) 19, 50, 72, 116, 145, 185
SmlI CTYRAG 1 cut(s) 133
SmoI CTYRAG 1 cut(s) 133
TaiI ACGT 1 cut(s) 18
TaqI TCGA 2 cut(s) 6, 147
TfiI GAWTC 1 cut(s) 108
TseFI GTSAC 2 cut(s) 55, 65
Tsp45I GTSAC 2 cut(s) 55, 65
TspDTI ATGAA 2 cut(s) 87, 93
XmiI GTMKAC 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.