Rroxscaffold_2G00097030

Coatomer subunit

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
18347693 .. 18350915
3223 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00097030.1

Sequence Viewer

Length: 192 bp
ATGTTCGAGTGCAACGTTGTTATATATAAGTTTGTGCAGGAACTTCACTTCTTTGTGATTGAAGGTGACGATGAAAATGAACTCATTTTAGCAACTCTACTTCATGGATTCTTTGATGCAGTTGCCCTTCTCTTGAGGAAAAATGTCGACAAAAGGGAGGCATTAGAGCACCTGGATCTCATACTCCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.37

Weight (kDa)

4.59

Isoelectric Point (pI)

34.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Clat_adaptor_s PF01217 6 - 58 3.5e-06 Clathrin adaptor complex small chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 147
AclI AACGTT 1 cut(s) 15
AclWI GGATC 1 cut(s) 183
AgsI TTSAA 1 cut(s) 62
AjnI CCWGG 1 cut(s) 171
Alw21I GWGCWC 1 cut(s) 171
AlwI GGATC 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 77
Bbv12I GWGCWC 1 cut(s) 171
BciT130I CCWGG 1 cut(s) 173
BfmI CTRYAG 1 cut(s) 188
Bme1390I CCNGG 1 cut(s) 173
BmrFI CCNGG 1 cut(s) 173
BmsI GCATC 1 cut(s) 106
BpuEI CTTGAG 1 cut(s) 154
BseBI CCWGG 1 cut(s) 173
BsgI GTGCAG 1 cut(s) 56
BsiHKAI GWGCWC 1 cut(s) 171
Bsp1286I GDGCHC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 175
BspPI GGATC 1 cut(s) 183
BssMI GATC 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 173
BstKTI GATC 1 cut(s) 178
BstMBI GATC 1 cut(s) 175
BstNI CCWGG 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 171
BstSFI CTRYAG 1 cut(s) 188
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
CviAII CATG 1 cut(s) 104
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
EcoRII CCWGG 1 cut(s) 171
FaeI CATG 1 cut(s) 107
FaiI YATR 6 cut(s) 23, 25, 27, 105, 182, 190
FatI CATG 1 cut(s) 103
FblI GTMKAC 1 cut(s) 147
Hin1II CATG 1 cut(s) 107
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HinfI GANTC 1 cut(s) 108
HphI GGTGA 1 cut(s) 77
Hpy166II GTNNAC 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 133
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 2 cut(s) 56, 137
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 3 cut(s) 12, 37, 119
HpySE526I ACGT 1 cut(s) 15
Hsp92II CATG 1 cut(s) 107
Kzo9I GATC 1 cut(s) 175
LpnPI CCDG 3 cut(s) 23, 158, 185
LweI GCATC 1 cut(s) 106
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 65
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MflI RGATCY 1 cut(s) 175
MhlI GDGCHC 1 cut(s) 171
MnlI CCTC 2 cut(s) 129, 151
MspR9I CCNGG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 173
NdeII GATC 1 cut(s) 175
NlaIII CATG 1 cut(s) 107
NmuCI GTSAC 1 cut(s) 65
PcsI WCGNNNNNNNCGW 1 cut(s) 12
PfeI GAWTC 1 cut(s) 108
Psp1406I AACGTT 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 171
PspGI CCWGG 1 cut(s) 171
PsuI RGATCY 1 cut(s) 175
SalI GTCGAC 1 cut(s) 146
Sau3AI GATC 1 cut(s) 175
ScrFI CCNGG 1 cut(s) 173
SduI GDGCHC 1 cut(s) 171
SetI ASST 3 cut(s) 18, 67, 174
SfaNI GCATC 1 cut(s) 106
SfcI CTRYAG 1 cut(s) 188
SgeI CNNG 6 cut(s) 19, 50, 116, 145, 184, 185
SmlI CTYRAG 1 cut(s) 133
SmoI CTYRAG 1 cut(s) 133
StyD4I CCNGG 1 cut(s) 171
TaiI ACGT 1 cut(s) 18
TaqI TCGA 2 cut(s) 6, 147
TfiI GAWTC 1 cut(s) 108
TseFI GTSAC 1 cut(s) 65
Tsp45I GTSAC 1 cut(s) 65
TspDTI ATGAA 3 cut(s) 87, 92, 93
XmiI GTMKAC 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.