RchiOBHm_Chr5g0078651

Coatomer subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
84477937 .. 84478316
380 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35316

Sequence Viewer

Length: 267 bp
ATGGTATTATTAAAGTACATACAGTGCCACTCCAGTGATTTTTTCTTTTTCTTTTTGATATGCTACAGAAAGTCATGTTATAACACCAGATTTGCAGTCTTCATAATTTACTATATTGTATCTTATGCAGTGGAGGTAATCATGTTCGAGTGCAACATTATATATAAGTTTGTGCAGGAACTTCACTTCTTTGTGGCTAGAGGTGACGATGAAAATGAACTCATTTTAGCAACTCTACTTCAGGGATTCTTTGATAAAAAATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.63

Weight (kDa)

6.04

Isoelectric Point (pI)

33.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 81
AcuI CTGAAG 1 cut(s) 224
AfaI GTAC 1 cut(s) 17
AleI CACNNNNGTG 1 cut(s) 33
AsuHPI GGTGA 1 cut(s) 215
BbsI GAAGAC 1 cut(s) 91
BfaI CTAG 1 cut(s) 198
BfmI CTRYAG 1 cut(s) 64
BpiI GAAGAC 1 cut(s) 91
BpmI CTGGAG 1 cut(s) 16
Bse1I ACTGG 1 cut(s) 33
BseNI ACTGG 1 cut(s) 33
BsgI GTGCAG 1 cut(s) 194
BsrI ACTGG 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 24
BstSFI CTRYAG 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 91
BtsI GCAGTG 1 cut(s) 135
BtsIMutI CAGTG 3 cut(s) 29, 40, 135
Csp6I GTAC 1 cut(s) 16
CviAII CATG 2 cut(s) 75, 142
CviJI RGCY 1 cut(s) 197
CviKI_1 RGCY 1 cut(s) 197
CviQI GTAC 1 cut(s) 16
Eco57I CTGAAG 1 cut(s) 224
FaeI CATG 2 cut(s) 78, 145
FatI CATG 2 cut(s) 74, 141
FspBI CTAG 1 cut(s) 198
GsuI CTGGAG 1 cut(s) 16
Hin1II CATG 2 cut(s) 78, 145
HinfI GANTC 1 cut(s) 246
HphI GGTGA 1 cut(s) 215
HpyCH4III ACNGT 1 cut(s) 24
HpyCH4V TGCA 4 cut(s) 95, 128, 153, 175
Hsp92II CATG 2 cut(s) 78, 145
LpnPI CCDG 4 cut(s) 46, 100, 161, 227
MaeI CTAG 1 cut(s) 198
MaeIII GTNAC 1 cut(s) 203
MboII GAAGA 1 cut(s) 91
MluCI AATT 1 cut(s) 105
MnlI CCTC 2 cut(s) 127, 194
MseI TTAA 1 cut(s) 11
MslI CAYNNNNRTG 1 cut(s) 33
NlaIII CATG 2 cut(s) 78, 145
NmuCI GTSAC 1 cut(s) 203
OliI CACNNNNGTG 1 cut(s) 33
PfeI GAWTC 1 cut(s) 246
PsiI TTATAA 1 cut(s) 81
RsaI GTAC 1 cut(s) 17
RsaNI GTAC 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 33
SaqAI TTAA 1 cut(s) 11
SetI ASST 2 cut(s) 138, 205
SfcI CTRYAG 1 cut(s) 64
SgeI CNNG 8 cut(s) 45, 87, 99, 154, 160, 188, 210, 254
SmiMI CAYNNNNRTG 1 cut(s) 33
Sse9I AATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 198
TaaI ACNGT 1 cut(s) 24
TaqI TCGA 1 cut(s) 147
TasI AATT 1 cut(s) 105
TatI WGTACW 1 cut(s) 15
TfiI GAWTC 1 cut(s) 246
Tru1I TTAA 1 cut(s) 11
Tru9I TTAA 1 cut(s) 11
TscAI CASTG 3 cut(s) 29, 40, 135
TseFI GTSAC 1 cut(s) 203
Tsp45I GTSAC 1 cut(s) 203
TspDTI ATGAA 3 cut(s) 91, 225, 231
TspRI CASTG 3 cut(s) 29, 40, 135
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.