RchiOBHm_Chr5g0044301
ERF Family

BEST Arabidopsis thaliana protein match is alpha beta-Hydrolases superfamily protein (TAIR

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
39634476 .. 39636989
2514 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32251

Sequence Viewer

Length: 285 bp
ATGATTGCCCCAGTAGTACTAGCTTTGACAGTGGGTTTTCTTGGGTGGGCATATCAGGCACTAAAGCCTCCCCCTCCCAAAATATGCGGTTCACCTGGTGGTCCTCCTGTCACTTCACCTAGAGTGAAACTCAGTGATGGTAGATATTTGGCCTACAGGGAGTTTGGAGTGCCTAAAGAAGAGGCAAAACACAAGATCATCATCATTCATGGCTTTAGCAGTTCCAAAGATCTGGCTTTACCTGTTTCTCAACAAGTGATCTTTTTGAACTCGTTGACGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

94

Amino Acids

10.1

Weight (kDa)

9.67

Isoelectric Point (pI)

44.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 87
AdeI CACNNNGTG 1 cut(s) 98
AfaI GTAC 1 cut(s) 18
AgsI TTSAA 1 cut(s) 268
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
AoxI GGCC 1 cut(s) 150
AspS9I GGNCC 1 cut(s) 101
AsuHPI GGTGA 2 cut(s) 84, 108
AvaII GGWCC 1 cut(s) 101
BccI CCATC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 96
BfaI CTAG 2 cut(s) 20, 120
BfmI CTRYAG 1 cut(s) 154
BglII AGATCT 1 cut(s) 229
BmcAI AGTACT 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 96
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 96
BmrI ACTGGG 1 cut(s) 5
BmuI ACTGGG 1 cut(s) 5
BplI GAGNNNNNCTC 2 cut(s) 114, 146
BsaBI GATNNNNATC 1 cut(s) 200
Bse1I ACTGG 1 cut(s) 11
Bse8I GATNNNNATC 1 cut(s) 200
BseBI CCWGG 1 cut(s) 96
BseJI GATNNNNATC 1 cut(s) 200
BseMII CTCAG 1 cut(s) 145
BseNI ACTGG 1 cut(s) 11
BshFI GGCC 1 cut(s) 152
BsnI GGCC 1 cut(s) 152
Bsp143I GATC 3 cut(s) 195, 229, 258
BspACI CCGC 1 cut(s) 87
BspANI GGCC 1 cut(s) 152
BspCNI CTCAG 1 cut(s) 144
BsrI ACTGG 1 cut(s) 11
BssMI GATC 3 cut(s) 195, 229, 258
Bst2UI CCWGG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 31
Bst6I CTCTTC 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 131
BstKTI GATC 3 cut(s) 198, 232, 261
BstMBI GATC 3 cut(s) 195, 229, 258
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstNI CCWGG 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 229
BstXI CCANNNNNNTGG 1 cut(s) 232
BstYI RGATCY 1 cut(s) 229
BsuRI GGCC 1 cut(s) 152
BtsIMutI CAGTG 2 cut(s) 36, 139
Cfr13I GGNCC 1 cut(s) 101
CsiI ACCWGGT 1 cut(s) 94
Csp6I GTAC 1 cut(s) 17
CviAII CATG 1 cut(s) 209
CviJI RGCY 5 cut(s) 23, 67, 152, 213, 236
CviKI_1 RGCY 5 cut(s) 23, 67, 152, 213, 236
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 1 cut(s) 131
DpnI GATC 3 cut(s) 197, 231, 260
DpnII GATC 3 cut(s) 195, 229, 258
DraIII CACNNNGTG 1 cut(s) 98
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
Eco47I GGWCC 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 212
FaiI YATR 3 cut(s) 52, 85, 210
FatI CATG 1 cut(s) 208
FspBI CTAG 2 cut(s) 20, 120
HaeIII GGCC 1 cut(s) 152
Hin1II CATG 1 cut(s) 212
HincII GTYRAC 1 cut(s) 276
HindII GTYRAC 1 cut(s) 276
HphI GGTGA 2 cut(s) 84, 108
Hpy166II GTNNAC 2 cut(s) 92, 276
Hpy8I GTNNAC 2 cut(s) 92, 276
HpyCH4III ACNGT 1 cut(s) 31
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpyF3I CTNAG 1 cut(s) 131
Hsp92II CATG 1 cut(s) 212
Kzo9I GATC 3 cut(s) 195, 229, 258
LpnPI CCDG 8 cut(s) 24, 41, 81, 108, 120, 142, 218, 255
MabI ACCWGGT 1 cut(s) 94
MaeI CTAG 2 cut(s) 20, 120
MaeIII GTNAC 1 cut(s) 109
MalI GATC 3 cut(s) 197, 231, 260
MboI GATC 3 cut(s) 195, 229, 258
MboII GAAGA 1 cut(s) 191
MflI RGATCY 1 cut(s) 229
MnlI CCTC 4 cut(s) 78, 84, 114, 175
MseI TTAA 1 cut(s) 283
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 56
NdeII GATC 3 cut(s) 195, 229, 258
NlaIII CATG 1 cut(s) 212
NmuCI GTSAC 1 cut(s) 109
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
PspPI GGNCC 1 cut(s) 101
PsuI RGATCY 1 cut(s) 229
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
SaqAI TTAA 1 cut(s) 283
Sau3AI GATC 3 cut(s) 195, 229, 258
Sau96I GGNCC 1 cut(s) 101
ScaI AGTACT 1 cut(s) 18
ScrFI CCNGG 1 cut(s) 96
SetI ASST 4 cut(s) 25, 97, 121, 244
SexAI ACCWGGT 1 cut(s) 94
SfcI CTRYAG 1 cut(s) 154
SinI GGWCC 1 cut(s) 101
SsiI CCGC 1 cut(s) 87
SspMI CTAG 2 cut(s) 20, 120
StyD4I CCNGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 31
TatI WGTACW 1 cut(s) 16
Tru1I TTAA 1 cut(s) 283
Tru9I TTAA 1 cut(s) 283
TscAI CASTG 2 cut(s) 36, 139
TseFI GTSAC 1 cut(s) 109
Tsp45I GTSAC 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 197
TspRI CASTG 2 cut(s) 36, 139
VpaK11BI GGWCC 1 cut(s) 101
XspI CTAG 2 cut(s) 20, 120
ZrmI AGTACT 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.