Rmu_co8478079.1_g000001
ERF Family

BEST Arabidopsis thaliana protein match is alpha beta-Hydrolases superfamily protein (TAIR

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8478079.1
OG0001884
Physical Location & Seq
Reverse (-)
71 .. 1741
1671 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8478079.1_g000001.1.cds

Sequence Viewer

Length: 324 bp
ctgcctcaaccggggatcacagtcaccagaggaacaagagagccagacccatttcaactttcagcaatgattgccccagtagtactagctttgacagtgggttttcttgggtgggcatatcaggcactaaagcctccccctcctaaaatatgtggttcacctggtggtcctcctgtcacttcacctagagtgaaactcagtgatggtagatatttggcctacagggagtttggagtgcctaaagaagaagcaaaacacaagatcatcatcattcatggctttagcagttccaaagatctggctttacctgtttctcaagtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_1 Abhydrolase_6 Hydrolase_4

Protein Analysis

107

Amino Acids

11.46

Weight (kDa)

9.67

Isoelectric Point (pI)

43.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 23
AdeI CACNNNGTG 1 cut(s) 164
AfaI GTAC 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 11
AgsI TTSAA 1 cut(s) 56
AjnI CCWGG 1 cut(s) 160
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AlwI GGATC 1 cut(s) 23
AoxI GGCC 1 cut(s) 216
AspS9I GGNCC 1 cut(s) 167
AsuC2I CCSGG 1 cut(s) 12
AsuHPI GGTGA 3 cut(s) 16, 150, 174
AvaII GGWCC 1 cut(s) 167
BccI CCATC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 162
BcnI CCSGG 1 cut(s) 12
BfaI CTAG 2 cut(s) 86, 186
BfmI CTRYAG 1 cut(s) 220
BglII AGATCT 1 cut(s) 295
BmcAI AGTACT 1 cut(s) 84
Bme1390I CCNGG 2 cut(s) 12, 162
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BmrFI CCNGG 2 cut(s) 12, 162
BmrI ACTGGG 1 cut(s) 71
BmuI ACTGGG 1 cut(s) 71
BplI GAGNNNNNCTC 2 cut(s) 180, 212
BpuEI CTTGAG 1 cut(s) 300
BpuMI CCSGG 1 cut(s) 12
BsaBI GATNNNNATC 1 cut(s) 266
BsaJI CCNNGG 1 cut(s) 11
Bsc4I CCNNNNNNNGG 1 cut(s) 11
Bse1I ACTGG 1 cut(s) 77
Bse3DI GCAATG 1 cut(s) 72
Bse8I GATNNNNATC 1 cut(s) 266
BseBI CCWGG 1 cut(s) 162
BseDI CCNNGG 1 cut(s) 11
BseJI GATNNNNATC 1 cut(s) 266
BseLI CCNNNNNNNGG 1 cut(s) 11
BseMI GCAATG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 211
BseNI ACTGG 1 cut(s) 77
BshFI GGCC 1 cut(s) 218
BsiSI CCGG 1 cut(s) 11
BslI CCNNNNNNNGG 1 cut(s) 11
BsnI GGCC 1 cut(s) 218
Bsp143I GATC 3 cut(s) 15, 261, 295
BspANI GGCC 1 cut(s) 218
BspCNI CTCAG 1 cut(s) 210
BspPI GGATC 1 cut(s) 23
BsrDI GCAATG 1 cut(s) 72
BsrI ACTGG 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 11
BssMI GATC 3 cut(s) 15, 261, 295
Bst2UI CCWGG 1 cut(s) 162
Bst4CI ACNGT 2 cut(s) 22, 97
BstAPI GCANNNNNTGC 1 cut(s) 71
BstDEI CTNAG 1 cut(s) 197
BstKTI GATC 3 cut(s) 18, 264, 298
BstMBI GATC 3 cut(s) 15, 261, 295
BstMWI GCNNNNNNNGC 2 cut(s) 71, 122
BstNI CCWGG 1 cut(s) 162
BstSCI CCNGG 2 cut(s) 10, 160
BstSFI CTRYAG 1 cut(s) 220
BstX2I RGATCY 1 cut(s) 295
BstXI CCANNNNNNTGG 1 cut(s) 298
BstYI RGATCY 1 cut(s) 295
BsuRI GGCC 1 cut(s) 218
BtsIMutI CAGTG 2 cut(s) 102, 205
Cfr13I GGNCC 1 cut(s) 167
CsiI ACCWGGT 1 cut(s) 160
Csp6I GTAC 1 cut(s) 83
CviAII CATG 1 cut(s) 275
CviJI RGCY 6 cut(s) 43, 89, 133, 218, 279, 302
CviKI_1 RGCY 6 cut(s) 43, 89, 133, 218, 279, 302
CviQI GTAC 1 cut(s) 83
DdeI CTNAG 1 cut(s) 197
DpnI GATC 3 cut(s) 17, 263, 297
DpnII GATC 3 cut(s) 15, 261, 295
DraIII CACNNNGTG 1 cut(s) 164
Eco47I GGWCC 1 cut(s) 167
EcoRII CCWGG 1 cut(s) 160
FaeI CATG 1 cut(s) 278
FaiI YATR 4 cut(s) 118, 151, 276, 322
FatI CATG 1 cut(s) 274
FspBI CTAG 2 cut(s) 86, 186
HaeIII GGCC 1 cut(s) 218
HapII CCGG 1 cut(s) 11
Hin1II CATG 1 cut(s) 278
HpaII CCGG 1 cut(s) 11
HphI GGTGA 3 cut(s) 16, 150, 174
Hpy166II GTNNAC 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 158
HpyCH4III ACNGT 2 cut(s) 22, 97
HpyF10VI GCNNNNNNNGC 2 cut(s) 71, 122
HpyF3I CTNAG 1 cut(s) 197
Hsp92II CATG 1 cut(s) 278
Kzo9I GATC 3 cut(s) 15, 261, 295
MabI ACCWGGT 1 cut(s) 160
MaeI CTAG 2 cut(s) 86, 186
MaeIII GTNAC 2 cut(s) 22, 175
MalI GATC 3 cut(s) 17, 263, 297
MboI GATC 3 cut(s) 15, 261, 295
MboII GAAGA 1 cut(s) 257
MflI RGATCY 1 cut(s) 295
MnlI CCTC 5 cut(s) 15, 23, 144, 150, 180
MspI CCGG 1 cut(s) 11
MspR9I CCNGG 2 cut(s) 12, 162
MvaI CCWGG 1 cut(s) 162
MwoI GCNNNNNNNGC 2 cut(s) 71, 122
NciI CCSGG 1 cut(s) 12
NdeII GATC 3 cut(s) 15, 261, 295
NlaIII CATG 1 cut(s) 278
NmuCI GTSAC 2 cut(s) 22, 175
Psp6I CCWGG 1 cut(s) 160
PspGI CCWGG 1 cut(s) 160
PspPI GGNCC 1 cut(s) 167
PsuI RGATCY 1 cut(s) 295
RsaI GTAC 1 cut(s) 84
RsaNI GTAC 1 cut(s) 83
Sau3AI GATC 3 cut(s) 15, 261, 295
Sau96I GGNCC 1 cut(s) 167
ScaI AGTACT 1 cut(s) 84
ScrFI CCNGG 2 cut(s) 12, 162
SetI ASST 4 cut(s) 91, 163, 187, 310
SexAI ACCWGGT 1 cut(s) 160
SfcI CTRYAG 1 cut(s) 220
SinI GGWCC 1 cut(s) 167
SmlI CTYRAG 1 cut(s) 315
SmoI CTYRAG 1 cut(s) 315
SspMI CTAG 2 cut(s) 86, 186
StyD4I CCNGG 2 cut(s) 10, 160
TaaI ACNGT 2 cut(s) 22, 97
TatI WGTACW 1 cut(s) 82
TscAI CASTG 2 cut(s) 102, 205
TseFI GTSAC 2 cut(s) 22, 175
Tsp45I GTSAC 2 cut(s) 22, 175
TspDTI ATGAA 1 cut(s) 263
TspRI CASTG 2 cut(s) 102, 205
VpaK11BI GGWCC 1 cut(s) 167
XspI CTAG 2 cut(s) 86, 186
ZrmI AGTACT 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.