Rroxscaffold_4G00311410
ERF Family

BEST Arabidopsis thaliana protein match is alpha beta-Hydrolases superfamily protein (TAIR

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
33955099 .. 33959826
4728 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00311410.1

Sequence Viewer

Length: 363 bp
ATGGCAAGTTACCAAGCACTAAAGCCTCCCCCTCCTAAAATATGCGGTTCGCCTGGTGGTCCTCCCGTCACTTCACCTAGAGTGAAAGTGATGGTAGATATTTGGCCTATAGGGAGTTTGGAGTGCCTAAAGAAGAGGCAAAACACAAGATCATCATCATTCATGGCTTTGGCAGTTCCAAAGATCTGGCTTTACCTATTTCTCAAGGTCCGGTGGGCGAACCGCTACTCCGAGGATTTGATGGCCTTCGCTAGCTGTCACACGAGAGACAGGGCGTTAGAGGGAGACCACGTTGGGCGGTCTTCACTTATCCGATGCCTAAGTCGGTCAATGCATATAGGCAACATAACAATAAAGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

120

Amino Acids

13.47

Weight (kDa)

9.97

Isoelectric Point (pI)

71.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 45, 223, 298
AjnI CCWGG 1 cut(s) 52
AloI GAACNNNNNNTCC 2 cut(s) 212, 244
AluBI AGCT 1 cut(s) 255
AluI AGCT 1 cut(s) 255
Alw26I GTCTC 2 cut(s) 261, 279
AoxI GGCC 2 cut(s) 104, 243
AspS9I GGNCC 2 cut(s) 59, 208
AsuHPI GGTGA 1 cut(s) 66
AsuNHI GCTAGC 1 cut(s) 251
AvaII GGWCC 2 cut(s) 59, 208
BauI CACGAG 1 cut(s) 262
BbsI GAAGAC 1 cut(s) 294
BccI CCATC 2 cut(s) 85, 235
BciT130I CCWGG 1 cut(s) 54
BcoDI GTCTC 2 cut(s) 261, 279
BfaI CTAG 2 cut(s) 78, 252
BfmI CTRYAG 1 cut(s) 108
BglII AGATCT 1 cut(s) 183
Bme1390I CCNGG 1 cut(s) 54
Bme18I GGWCC 2 cut(s) 59, 208
BmgT120I GGNCC 2 cut(s) 59, 208
BmrFI CCNGG 1 cut(s) 54
BmsI GCATC 1 cut(s) 305
BmtI GCTAGC 1 cut(s) 255
BpiI GAAGAC 1 cut(s) 294
BpuEI CTTGAG 1 cut(s) 188
BsaBI GATNNNNATC 1 cut(s) 154
BsaI GGTCTC 1 cut(s) 279
BsaJI CCNNGG 1 cut(s) 231
BsaWI WCCGGW 1 cut(s) 210
BsaXI ACNNNNNCTCC 4 cut(s) 212, 242, 276, 306
Bse8I GATNNNNATC 1 cut(s) 154
BseBI CCWGG 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 231
BseJI GATNNNNATC 1 cut(s) 154
BshFI GGCC 2 cut(s) 106, 245
BsiSI CCGG 1 cut(s) 211
BsmAI GTCTC 2 cut(s) 261, 279
BsnI GGCC 2 cut(s) 106, 245
Bso31I GGTCTC 1 cut(s) 279
Bsp143I GATC 2 cut(s) 149, 183
BspACI CCGC 3 cut(s) 45, 223, 298
BspANI GGCC 2 cut(s) 106, 245
BspOI GCTAGC 1 cut(s) 255
BspTNI GGTCTC 1 cut(s) 279
BssECI CCNNGG 1 cut(s) 231
BssMI GATC 2 cut(s) 149, 183
BssSI CACGAG 1 cut(s) 262
Bst2BI CACGAG 1 cut(s) 262
Bst2UI CCWGG 1 cut(s) 54
Bst6I CTCTTC 1 cut(s) 128
BstC8I GCNNGC 1 cut(s) 253
BstDEI CTNAG 1 cut(s) 320
BstKTI GATC 2 cut(s) 152, 186
BstMAI GTCTC 2 cut(s) 261, 279
BstMBI GATC 2 cut(s) 149, 183
BstNI CCWGG 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 52
BstSFI CTRYAG 1 cut(s) 108
BstV2I GAAGAC 1 cut(s) 294
BstX2I RGATCY 1 cut(s) 183
BstXI CCANNNNNNTGG 1 cut(s) 186
BstYI RGATCY 1 cut(s) 183
BsuRI GGCC 2 cut(s) 106, 245
Cac8I GCNNGC 1 cut(s) 253
Cfr13I GGNCC 2 cut(s) 59, 208
CviAII CATG 1 cut(s) 163
CviJI RGCY 6 cut(s) 25, 106, 167, 190, 245, 255
CviKI_1 RGCY 6 cut(s) 25, 106, 167, 190, 245, 255
DdeI CTNAG 1 cut(s) 320
DpnI GATC 2 cut(s) 151, 185
DpnII GATC 2 cut(s) 149, 183
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
Eco31I GGTCTC 1 cut(s) 279
Eco47I GGWCC 2 cut(s) 59, 208
EcoRII CCWGG 1 cut(s) 52
EcoT22I ATGCAT 1 cut(s) 336
FaeI CATG 1 cut(s) 166
FaiI YATR 6 cut(s) 43, 110, 164, 336, 338, 347
FatI CATG 1 cut(s) 162
FspBI CTAG 2 cut(s) 78, 252
HaeIII GGCC 2 cut(s) 106, 245
HapII CCGG 1 cut(s) 211
Hin1II CATG 1 cut(s) 166
HpaII CCGG 1 cut(s) 211
HphI GGTGA 1 cut(s) 66
Hpy188I TCNGA 2 cut(s) 232, 314
HpyAV CCTTC 1 cut(s) 256
HpyCH4IV ACGT 1 cut(s) 291
HpyCH4V TGCA 1 cut(s) 334
HpyF3I CTNAG 1 cut(s) 320
HpySE526I ACGT 1 cut(s) 291
Hsp92II CATG 1 cut(s) 166
Kzo9I GATC 2 cut(s) 149, 183
LpnPI CCDG 5 cut(s) 39, 66, 172, 224, 256
LweI GCATC 1 cut(s) 305
MaeI CTAG 2 cut(s) 78, 252
MaeII ACGT 1 cut(s) 291
MaeIII GTNAC 3 cut(s) 8, 67, 257
MalI GATC 2 cut(s) 151, 185
MboI GATC 2 cut(s) 149, 183
MboII GAAGA 2 cut(s) 145, 294
MflI RGATCY 1 cut(s) 183
MnlI CCTC 6 cut(s) 36, 42, 72, 129, 226, 274
Mph1103I ATGCAT 1 cut(s) 336
MspI CCGG 1 cut(s) 211
MspR9I CCNGG 1 cut(s) 54
MvaI CCWGG 1 cut(s) 54
NdeII GATC 2 cut(s) 149, 183
NheI GCTAGC 1 cut(s) 251
NlaIII CATG 1 cut(s) 166
NmuCI GTSAC 2 cut(s) 67, 257
NsiI ATGCAT 1 cut(s) 336
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
PspPI GGNCC 2 cut(s) 59, 208
PsuI RGATCY 1 cut(s) 183
Sau3AI GATC 2 cut(s) 149, 183
Sau96I GGNCC 2 cut(s) 59, 208
ScrFI CCNGG 1 cut(s) 54
SetI ASST 5 cut(s) 79, 198, 210, 257, 294
SfaNI GCATC 1 cut(s) 305
SfcI CTRYAG 1 cut(s) 108
SinI GGWCC 2 cut(s) 59, 208
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
SsiI CCGC 3 cut(s) 45, 223, 298
SspMI CTAG 2 cut(s) 78, 252
StyD4I CCNGG 1 cut(s) 52
TaiI ACGT 1 cut(s) 294
TaqII GACCGA 1 cut(s) 315
TseFI GTSAC 2 cut(s) 67, 257
Tsp45I GTSAC 2 cut(s) 67, 257
TspDTI ATGAA 1 cut(s) 151
VpaK11BI GGWCC 2 cut(s) 59, 208
XspI CTAG 2 cut(s) 78, 252
Zsp2I ATGCAT 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.