RchiOBHm_Chr5g0082141

Protein of unknown function, DUF538

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
88126639 .. 88129731
3093 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35636

Sequence Viewer

Length: 222 bp
ATGCATATGGAACAAGGGTCTGATTCAGTTGAGTTTTACGTTGGGGCTTTGTCCGAGAAATTGCCTGCTAAACAGTTCATTGATATTCCTATTTGTAAGAGTAATGCTTGCCGAGGAGGAGCTAGTGTTGAGTCAATGAGACAGAAAAATGTCGATGGAGTCGGAAATTGGATGAAGGACAAGGTGTGCAGATGTTTCTATCTTGCAATCACTTTGTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.11

Weight (kDa)

7.61

Isoelectric Point (pI)

42.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 216
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
Alw26I GTCTC 1 cut(s) 133
BccI CCATC 1 cut(s) 149
BcoDI GTCTC 1 cut(s) 133
BfaI CTAG 2 cut(s) 123, 220
BsaJI CCNNGG 1 cut(s) 112
BsaXI ACNNNNNCTCC 2 cut(s) 111, 141
BseDI CCNNGG 1 cut(s) 112
BseGI GGATG 1 cut(s) 177
BseRI GAGGAG 2 cut(s) 129, 132
BsgI GTGCAG 1 cut(s) 208
BsmAI GTCTC 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 75
BstC8I GCNNGC 2 cut(s) 66, 109
BstF5I GGATG 1 cut(s) 177
BstMAI GTCTC 1 cut(s) 133
BtsCI GGATG 1 cut(s) 177
Cac8I GCNNGC 2 cut(s) 66, 109
CviJI RGCY 2 cut(s) 47, 122
CviKI_1 RGCY 2 cut(s) 47, 122
DraIII CACNNNGTG 1 cut(s) 216
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 2 cut(s) 6, 8
FauNDI CATATG 1 cut(s) 6
FokI GGATG 1 cut(s) 184
FspBI CTAG 2 cut(s) 123, 220
HinfI GANTC 3 cut(s) 23, 131, 159
Hpy188I TCNGA 3 cut(s) 22, 55, 164
HpyAV CCTTC 1 cut(s) 169
HpyCH4III ACNGT 1 cut(s) 75
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 3 cut(s) 4, 189, 206
HpySE526I ACGT 1 cut(s) 39
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 1 cut(s) 78
MaeI CTAG 2 cut(s) 123, 220
MaeII ACGT 1 cut(s) 39
MluCI AATT 2 cut(s) 59, 166
MlyI GAGTC 2 cut(s) 140, 168
MmeI TCCRAC 1 cut(s) 142
MnlI CCTC 2 cut(s) 107, 110
Mph1103I ATGCAT 1 cut(s) 6
NdeI CATATG 1 cut(s) 6
NmeAIII GCCGAG 1 cut(s) 137
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 23
PleI GAGTC 2 cut(s) 139, 167
PpsI GAGTC 2 cut(s) 139, 167
SchI GAGTC 2 cut(s) 140, 168
SetI ASST 3 cut(s) 42, 124, 186
SgeI CNNG 8 cut(s) 26, 67, 77, 120, 125, 135, 193, 215
Sse9I AATT 2 cut(s) 59, 166
SspMI CTAG 2 cut(s) 123, 220
TaaI ACNGT 1 cut(s) 75
TaiI ACGT 1 cut(s) 42
TaqI TCGA 1 cut(s) 153
TasI AATT 2 cut(s) 59, 166
TfiI GAWTC 1 cut(s) 23
TspDTI ATGAA 2 cut(s) 67, 188
XspI CTAG 2 cut(s) 123, 220
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.