RchiOBHm_Chr6g0271151

Uncharacterized protein family UPF0054

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
29440740 .. 29441089
350 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24324

Sequence Viewer

Length: 240 bp
ATGAGAAAACATAACAAGGAATGGAGAGACGAGGACAGTGCTCCTAGTGTTGTTTCCAAGTCCAAGCATGTGCCTGGTCTTAAGATTCCAAATGTTGTGTTGGGTGACATTGTGATTTCTGTTGAGATGGTGGCAAGGCAAGCAGAGCAAAGAGGCCACACACTTCTTGATGAGATGCGCCTTCTCATGGTAGGACTACTAGTGCTTATATTTCTCTTGCTATATGTAACATTTTGTTGA

Protein Analysis

79

Amino Acids

8.98

Weight (kDa)

7.95

Isoelectric Point (pI)

22.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
YbeY PF02130 1 - 64 1.4e-09 Endoribonuclease YbeY
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 187
AflII CTTAAG 1 cut(s) 80
AhlI ACTAGT 1 cut(s) 199
AjnI CCWGG 1 cut(s) 73
Alw21I GWGCWC 1 cut(s) 43
Alw26I GTCTC 1 cut(s) 21
AoxI GGCC 1 cut(s) 154
AspLEI GCGC 1 cut(s) 180
AsuHPI GGTGA 1 cut(s) 116
Bbv12I GWGCWC 1 cut(s) 43
BccI CCATC 1 cut(s) 121
BcgI CGANNNNNNTGC 2 cut(s) 20, 54
BciT130I CCWGG 1 cut(s) 75
BcoDI GTCTC 1 cut(s) 21
BcuI ACTAGT 1 cut(s) 199
BfaI CTAG 2 cut(s) 45, 200
BfrI CTTAAG 1 cut(s) 80
Bme1390I CCNGG 1 cut(s) 75
BmrFI CCNGG 1 cut(s) 75
BmsI GCATC 1 cut(s) 165
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseBI CCWGG 1 cut(s) 75
BseLI CCNNNNNNNGG 1 cut(s) 187
BshFI GGCC 1 cut(s) 156
BsiHKAI GWGCWC 1 cut(s) 43
BslI CCNNNNNNNGG 1 cut(s) 187
BsmAI GTCTC 1 cut(s) 21
BsmBI CGTCTC 1 cut(s) 21
BsnI GGCC 1 cut(s) 156
Bsp1286I GDGCHC 1 cut(s) 43
BspANI GGCC 1 cut(s) 156
BspTI CTTAAG 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 38
BstAFI CTTAAG 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 141
BstHHI GCGC 1 cut(s) 180
BstMAI GTCTC 1 cut(s) 21
BstMWI GCNNNNNNNGC 2 cut(s) 140, 145
BstNI CCWGG 1 cut(s) 75
BstNSI RCATGY 1 cut(s) 71
BstSCI CCNGG 1 cut(s) 73
BsuRI GGCC 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 141
CfoI GCGC 1 cut(s) 180
CviAII CATG 2 cut(s) 68, 187
CviJI RGCY 1 cut(s) 156
CviKI_1 RGCY 1 cut(s) 156
EcoRII CCWGG 1 cut(s) 73
Esp3I CGTCTC 1 cut(s) 21
FaeI CATG 2 cut(s) 71, 190
FaiI YATR 6 cut(s) 12, 69, 188, 209, 223, 225
FatI CATG 2 cut(s) 67, 186
FspBI CTAG 2 cut(s) 45, 200
GlaI GCGC 1 cut(s) 179
HaeIII GGCC 1 cut(s) 156
HhaI GCGC 1 cut(s) 180
Hin1II CATG 2 cut(s) 71, 190
Hin6I GCGC 1 cut(s) 178
HinP1I GCGC 1 cut(s) 178
HinfI GANTC 1 cut(s) 85
HphI GGTGA 1 cut(s) 116
Hpy188III TCNNGA 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 191
HpyCH4III ACNGT 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 2 cut(s) 140, 145
Hsp92II CATG 2 cut(s) 71, 190
HspAI GCGC 1 cut(s) 178
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 2 cut(s) 60, 87
LweI GCATC 1 cut(s) 165
MaeI CTAG 2 cut(s) 45, 200
MaeIII GTNAC 2 cut(s) 104, 226
MhlI GDGCHC 1 cut(s) 43
MnlI CCTC 2 cut(s) 25, 146
MseI TTAA 1 cut(s) 81
MspCI CTTAAG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
MwoI GCNNNNNNNGC 2 cut(s) 140, 145
NlaIII CATG 2 cut(s) 71, 190
NmuCI GTSAC 1 cut(s) 104
NspI RCATGY 1 cut(s) 71
PfeI GAWTC 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
SaqAI TTAA 1 cut(s) 81
ScrFI CCNGG 1 cut(s) 75
SduI GDGCHC 1 cut(s) 43
SfaNI GCATC 1 cut(s) 165
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
SpeI ACTAGT 1 cut(s) 199
SspMI CTAG 2 cut(s) 45, 200
StyD4I CCNGG 1 cut(s) 73
TaaI ACNGT 1 cut(s) 38
TfiI GAWTC 1 cut(s) 85
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 1 cut(s) 104
Tsp45I GTSAC 1 cut(s) 104
TspRI CASTG 1 cut(s) 43
Vha464I CTTAAG 1 cut(s) 80
XceI RCATGY 1 cut(s) 71
XspI CTAG 2 cut(s) 45, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.