RchiOBHm_Chr6g0291191

Pentatricopeptide repeat-containing protein At4g35850

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
54369557 .. 54371448
1892 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26129

Sequence Viewer

Length: 150 bp
ATGCTAATGGATGGAAAATATCTTGATACCTATATTGTGATTCAAACCATGAGATGCTATTTGAACTGTGATGATATTGATCGTGGTGTGCAAACCCCTGATGACTATCTGAAGTTAGGGAAGCTTCCTGCACCAGAACTCATAACATAA

Protein Analysis

49

Amino Acids

5.65

Weight (kDa)

4.36

Isoelectric Point (pI)

8.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 131
AgsI TTSAA 2 cut(s) 44, 64
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
BccI CCATC 1 cut(s) 5
BmsI GCATC 1 cut(s) 44
BsaBI GATNNNNATC 2 cut(s) 78, 105
Bse8I GATNNNNATC 2 cut(s) 78, 105
BseGI GGATG 1 cut(s) 16
BseJI GATNNNNATC 2 cut(s) 78, 105
BsgI GTGCAG 1 cut(s) 114
Bsp143I GATC 1 cut(s) 79
BssMI GATC 1 cut(s) 79
Bst4CI ACNGT 1 cut(s) 68
BstF5I GGATG 1 cut(s) 16
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BtsCI GGATG 1 cut(s) 16
CviAII CATG 1 cut(s) 49
CviJI RGCY 1 cut(s) 124
CviKI_1 RGCY 1 cut(s) 124
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eco57I CTGAAG 1 cut(s) 131
FaeI CATG 1 cut(s) 52
FaiI YATR 4 cut(s) 33, 50, 143, 148
FatI CATG 1 cut(s) 48
FokI GGATG 1 cut(s) 23
FspEI CC 9 cut(s) 43, 61, 69, 102, 103, 109, 110, 111, 141
Hin1II CATG 1 cut(s) 52
HindIII AAGCTT 1 cut(s) 122
HinfI GANTC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 111
Hpy188III TCNNGA 1 cut(s) 23
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 2 cut(s) 91, 131
Hsp92II CATG 1 cut(s) 52
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 2 cut(s) 111, 141
LweI GCATC 1 cut(s) 44
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
NdeII GATC 1 cut(s) 79
NlaIII CATG 1 cut(s) 52
PfeI GAWTC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 79
SetI ASST 2 cut(s) 32, 126
SfaNI GCATC 1 cut(s) 44
SgeI CNNG 6 cut(s) 35, 61, 95, 110, 140, 146
TaaI ACNGT 1 cut(s) 68
TfiI GAWTC 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.