Rh3DG228100

Pentatricopeptide repeat-containing protein At4g35850

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
21579540 .. 21581231
1692 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG228100.1

Sequence Viewer

Length: 258 bp
ATGAGCATGCCGAACTACATATCAGTCACCAACCAATGGAATCTTTTCTGGTTTTCTGTTTTTGATTGGGTTCTGCAATTCTTAAAGGTGATGGAAGCTCTTTTGGACATGCTAAAGGATGGAAAATATCTTGATACCTATATTGTGATTCAAACTATGAGATGCTATTTGAACTGTGATGATATTGATCGTGGTGTGCAAACCCCTGATGACTATCTGAAGTTAGGGAAGCTTCCTGCACCAGAACTCATAACATAA

Protein Analysis

85

Amino Acids

10.05

Weight (kDa)

4.39

Isoelectric Point (pI)

17.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 36
AcuI CTGAAG 1 cut(s) 239
AfiI CCNNNNNNNGG 1 cut(s) 36
AgsI TTSAA 2 cut(s) 152, 172
AluBI AGCT 2 cut(s) 98, 232
AluI AGCT 2 cut(s) 98, 232
Asp700I GAANNNNTTC 1 cut(s) 44
AsuHPI GGTGA 2 cut(s) 19, 100
BccI CCATC 2 cut(s) 85, 113
BmsI GCATC 1 cut(s) 152
BsaBI GATNNNNATC 2 cut(s) 186, 213
Bsc4I CCNNNNNNNGG 1 cut(s) 36
Bse8I GATNNNNATC 2 cut(s) 186, 213
BseGI GGATG 1 cut(s) 124
BseJI GATNNNNATC 2 cut(s) 186, 213
BseLI CCNNNNNNNGG 1 cut(s) 36
BsgI GTGCAG 1 cut(s) 222
BslI CCNNNNNNNGG 1 cut(s) 36
Bsp143I GATC 1 cut(s) 187
BssMI GATC 1 cut(s) 187
Bst4CI ACNGT 1 cut(s) 176
BstC8I GCNNGC 1 cut(s) 8
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstNSI RCATGY 2 cut(s) 10, 112
BtsCI GGATG 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 8
CviAII CATG 2 cut(s) 7, 109
CviJI RGCY 2 cut(s) 98, 232
CviKI_1 RGCY 2 cut(s) 98, 232
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 239
FaeI CATG 2 cut(s) 10, 112
FaiI YATR 7 cut(s) 8, 20, 110, 141, 158, 251, 256
FatI CATG 2 cut(s) 6, 108
FokI GGATG 1 cut(s) 131
Hin1II CATG 2 cut(s) 10, 112
HindIII AAGCTT 1 cut(s) 230
HinfI GANTC 2 cut(s) 40, 148
HphI GGTGA 2 cut(s) 19, 100
Hpy188I TCNGA 1 cut(s) 219
Hpy188III TCNNGA 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 176
HpyCH4V TGCA 3 cut(s) 76, 199, 239
Hsp92II CATG 2 cut(s) 10, 112
Kzo9I GATC 1 cut(s) 187
LpnPI CCDG 3 cut(s) 34, 219, 249
LweI GCATC 1 cut(s) 152
MaeIII GTNAC 1 cut(s) 25
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MluCI AATT 1 cut(s) 77
MroXI GAANNNNTTC 1 cut(s) 44
MseI TTAA 1 cut(s) 83
NdeII GATC 1 cut(s) 187
NlaIII CATG 2 cut(s) 10, 112
NmuCI GTSAC 1 cut(s) 25
NspI RCATGY 2 cut(s) 10, 112
PaeI GCATGC 1 cut(s) 10
PdmI GAANNNNTTC 1 cut(s) 44
PfeI GAWTC 2 cut(s) 40, 148
PflMI CCANNNNNTGG 1 cut(s) 36
SaqAI TTAA 1 cut(s) 83
Sau3AI GATC 1 cut(s) 187
SetI ASST 4 cut(s) 90, 100, 140, 234
SfaNI GCATC 1 cut(s) 152
SgeI CNNG 8 cut(s) 19, 61, 121, 143, 203, 218, 248, 254
SphI GCATGC 1 cut(s) 10
Sse9I AATT 1 cut(s) 77
TaaI ACNGT 1 cut(s) 176
TasI AATT 1 cut(s) 77
TfiI GAWTC 2 cut(s) 40, 148
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TseFI GTSAC 1 cut(s) 25
Tsp45I GTSAC 1 cut(s) 25
Van91I CCANNNNNTGG 1 cut(s) 36
XceI RCATGY 2 cut(s) 10, 112
XmnI GAANNNNTTC 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.