Rh2AG521200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
74856934 .. 74869090
12157 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG521200.1

Sequence Viewer

Length: 297 bp
ATGGGCGACTCCTTGTCGTTCAGCCCAAACTGGTGGAGCCTGGACGACGACTGGCACAAAATGAATATGTTGCTGTACATCGAGATCTTCGACAGCGACAACGAGAGGCTCGAGATTCCCCAAAACAAGTCGGGTCGCAGATGGCTAGACTCAACCCCTGTCTCAACGCCAAAAGAATTGGGAATTGAGATGGGGATAGCTGATGTGATTTTGGACCTTGTGAGTACTAGGAGGACACTAAAAGAAAACAAGGGAGGAATTACATGTGTTGAGAAGTCAGAACTGTGGGTGGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.27

Weight (kDa)

4.64

Isoelectric Point (pI)

69.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 77, 226
AflIII ACRYGT 1 cut(s) 263
AhdI GACNNNNNGTC 1 cut(s) 13
AjnI CCWGG 1 cut(s) 39
AluBI AGCT 1 cut(s) 200
AluI AGCT 1 cut(s) 200
Alw26I GTCTC 1 cut(s) 166
Ama87I CYCGRG 1 cut(s) 110
AspS9I GGNCC 1 cut(s) 214
AvaI CYCGRG 1 cut(s) 110
AvaII GGWCC 1 cut(s) 214
BccI CCATC 2 cut(s) 135, 184
BciT130I CCWGG 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 166
BfaI CTAG 2 cut(s) 146, 228
BglII AGATCT 1 cut(s) 84
BmcAI AGTACT 1 cut(s) 226
Bme1390I CCNGG 1 cut(s) 41
Bme18I GGWCC 1 cut(s) 214
BmeRI GACNNNNNGTC 1 cut(s) 13
BmeT110I CYCGRG 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 214
BmiI GGNNCC 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 41
Bse1I ACTGG 2 cut(s) 35, 56
BseBI CCWGG 1 cut(s) 41
BseNI ACTGG 2 cut(s) 35, 56
BsiHKCI CYCGRG 1 cut(s) 110
BsmAI GTCTC 1 cut(s) 166
BsoBI CYCGRG 1 cut(s) 110
Bsp1407I TGTACA 1 cut(s) 75
Bsp143I GATC 1 cut(s) 84
BspLI GGNNCC 1 cut(s) 38
BsrGI TGTACA 1 cut(s) 75
BsrI ACTGG 2 cut(s) 35, 56
BssMI GATC 1 cut(s) 84
Bst2UI CCWGG 1 cut(s) 41
Bst4CI ACNGT 1 cut(s) 285
BstAUI TGTACA 1 cut(s) 75
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 1 cut(s) 166
BstMBI GATC 1 cut(s) 84
BstNI CCWGG 1 cut(s) 41
BstNSI RCATGY 1 cut(s) 267
BstSCI CCNGG 1 cut(s) 39
BstX2I RGATCY 1 cut(s) 84
BstXI CCANNNNNNTGG 1 cut(s) 33
BstYI RGATCY 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 214
Csp6I GTAC 2 cut(s) 76, 225
CviAII CATG 1 cut(s) 264
CviJI RGCY 5 cut(s) 24, 39, 109, 145, 200
CviKI_1 RGCY 5 cut(s) 24, 39, 109, 145, 200
CviQI GTAC 2 cut(s) 76, 225
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
DriI GACNNNNNGTC 1 cut(s) 13
Eam1105I GACNNNNNGTC 1 cut(s) 13
Eco47I GGWCC 1 cut(s) 214
Eco88I CYCGRG 1 cut(s) 110
EcoRII CCWGG 1 cut(s) 39
FaeI CATG 1 cut(s) 267
FaiI YATR 3 cut(s) 68, 265, 295
FatI CATG 1 cut(s) 263
FspBI CTAG 2 cut(s) 146, 228
Hin1II CATG 1 cut(s) 267
HinfI GANTC 3 cut(s) 8, 115, 149
Hpy188I TCNGA 1 cut(s) 280
Hpy188III TCNNGA 2 cut(s) 82, 112
Hpy99I CGWCG 1 cut(s) 50
HpyCH4III ACNGT 1 cut(s) 285
Hsp92II CATG 1 cut(s) 267
Kzo9I GATC 1 cut(s) 84
LmnI GCTCC 1 cut(s) 36
LpnPI CCDG 5 cut(s) 16, 26, 37, 53, 171
MaeI CTAG 2 cut(s) 146, 228
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 1 cut(s) 79
MflI RGATCY 1 cut(s) 84
MluCI AATT 3 cut(s) 176, 183, 258
MlyI GAGTC 2 cut(s) 2, 143
MnlI CCTC 3 cut(s) 99, 225, 248
MspR9I CCNGG 1 cut(s) 41
MvaI CCWGG 1 cut(s) 41
NdeII GATC 1 cut(s) 84
NlaIII CATG 1 cut(s) 267
NlaIV GGNNCC 1 cut(s) 38
NspI RCATGY 1 cut(s) 267
PaeR7I CTCGAG 1 cut(s) 110
PciI ACATGT 1 cut(s) 263
PcsI WCGNNNNNNNCGW 2 cut(s) 87, 108
PfeI GAWTC 1 cut(s) 115
PleI GAGTC 2 cut(s) 2, 143
PpsI GAGTC 2 cut(s) 2, 143
PscI ACATGT 1 cut(s) 263
Psp6I CCWGG 1 cut(s) 39
PspGI CCWGG 1 cut(s) 39
PspN4I GGNNCC 1 cut(s) 38
PspPI GGNCC 1 cut(s) 214
PsuI RGATCY 1 cut(s) 84
RsaI GTAC 2 cut(s) 77, 226
RsaNI GTAC 2 cut(s) 76, 225
Sau3AI GATC 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 214
ScaI AGTACT 1 cut(s) 226
SchI GAGTC 2 cut(s) 2, 143
ScrFI CCNGG 1 cut(s) 41
SetI ASST 2 cut(s) 202, 219
Sfr274I CTCGAG 1 cut(s) 110
SinI GGWCC 1 cut(s) 214
SlaI CTCGAG 1 cut(s) 110
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 3 cut(s) 176, 183, 258
SspMI CTAG 2 cut(s) 146, 228
StyD4I CCNGG 1 cut(s) 39
TaaI ACNGT 1 cut(s) 285
TaqI TCGA 3 cut(s) 81, 90, 111
TasI AATT 3 cut(s) 176, 183, 258
TatI WGTACW 2 cut(s) 75, 224
TfiI GAWTC 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 77
VpaK11BI GGWCC 1 cut(s) 214
XceI RCATGY 1 cut(s) 267
XhoI CTCGAG 1 cut(s) 110
XspI CTAG 2 cut(s) 146, 228
ZrmI AGTACT 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.