Rh6AG329100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0003017
Physical Location & Seq
Forward (+)
53091740 .. 53114703
22964 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG329100.1

Sequence Viewer

Length: 336 bp
ATGACTAGAGAGGACTACTGGCCTTCTCTGAGTCCACTATATTTCACCAGCGACGCCTTGTCGTTCGGCCCAAACTGGTGGAGCCTGGACGACGATTGGCACAGAATAAATATGTTGCTGTACATCGAGGTCTTCGACAGCGGTGACGAGAGGCTCGAGATTCCCCAGAACAAGTCGAGTCGCAGATGGCTAGACTCAACCCCTGTCTCAACGCCAGAAGAATTGGGAATTAAGGTGATGGAAGCTCTTTTGGACATGCTAAAGGATGGAAAATATCTTGATACCTATATTGTGATTCAAACCATGAGGGTGGAGTCCTATGAGTTGAATCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

13.16

Weight (kDa)

4.33

Isoelectric Point (pI)

46.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 141
AcyI GRCGYC 1 cut(s) 54
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 2 cut(s) 299, 328
AhdI GACNNNNNGTC 1 cut(s) 58
AjnI CCWGG 1 cut(s) 84
AluBI AGCT 1 cut(s) 245
AluI AGCT 1 cut(s) 245
Alw26I GTCTC 1 cut(s) 211
Ama87I CYCGRG 1 cut(s) 155
AoxI GGCC 2 cut(s) 20, 67
AspS9I GGNCC 1 cut(s) 68
AsuHPI GGTGA 3 cut(s) 37, 155, 247
AvaI CYCGRG 1 cut(s) 155
BbsI GAAGAC 1 cut(s) 124
BccI CCATC 3 cut(s) 180, 232, 260
BciT130I CCWGG 1 cut(s) 86
BcoDI GTCTC 1 cut(s) 211
BfaI CTAG 2 cut(s) 6, 191
Bme1390I CCNGG 1 cut(s) 86
BmeRI GACNNNNNGTC 1 cut(s) 58
BmeT110I CYCGRG 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 68
BmiI GGNNCC 1 cut(s) 83
BmrFI CCNGG 1 cut(s) 86
BpiI GAAGAC 1 cut(s) 124
BsaHI GRCGYC 1 cut(s) 54
Bse1I ACTGG 2 cut(s) 23, 80
BseBI CCWGG 1 cut(s) 86
BseGI GGATG 1 cut(s) 271
BseMII CTCAG 1 cut(s) 20
BseNI ACTGG 2 cut(s) 23, 80
BshFI GGCC 2 cut(s) 22, 69
BsiHKCI CYCGRG 1 cut(s) 155
BsmAI GTCTC 1 cut(s) 211
BsnI GGCC 2 cut(s) 22, 69
BsoBI CYCGRG 1 cut(s) 155
Bsp1407I TGTACA 1 cut(s) 120
BspACI CCGC 1 cut(s) 141
BspANI GGCC 2 cut(s) 22, 69
BspCNI CTCAG 1 cut(s) 21
BspLI GGNNCC 1 cut(s) 83
BsrGI TGTACA 1 cut(s) 120
BsrI ACTGG 2 cut(s) 23, 80
BssNI GRCGYC 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 86
BstACI GRCGYC 1 cut(s) 54
BstAUI TGTACA 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 29
BstF5I GGATG 1 cut(s) 271
BstMAI GTCTC 1 cut(s) 211
BstNI CCWGG 1 cut(s) 86
BstNSI RCATGY 1 cut(s) 259
BstSCI CCNGG 1 cut(s) 84
BstV2I GAAGAC 1 cut(s) 124
BstXI CCANNNNNNTGG 2 cut(s) 78, 310
BsuRI GGCC 2 cut(s) 22, 69
BtsCI GGATG 1 cut(s) 271
Cfr13I GGNCC 1 cut(s) 68
CseI GACGC 1 cut(s) 62
Csp6I GTAC 1 cut(s) 121
CviAII CATG 2 cut(s) 256, 304
CviJI RGCY 6 cut(s) 22, 69, 84, 154, 190, 245
CviKI_1 RGCY 6 cut(s) 22, 69, 84, 154, 190, 245
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 1 cut(s) 29
DriI GACNNNNNGTC 1 cut(s) 58
Eam1105I GACNNNNNGTC 1 cut(s) 58
Eco88I CYCGRG 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 84
FaeI CATG 2 cut(s) 259, 307
FaiI YATR 6 cut(s) 40, 113, 257, 288, 305, 321
FatI CATG 2 cut(s) 255, 303
FokI GGATG 1 cut(s) 278
FspBI CTAG 2 cut(s) 6, 191
HaeIII GGCC 2 cut(s) 22, 69
HgaI GACGC 1 cut(s) 62
Hin1I GRCGYC 1 cut(s) 54
Hin1II CATG 2 cut(s) 259, 307
HinfI GANTC 7 cut(s) 31, 160, 178, 194, 295, 314, 328
HphI GGTGA 3 cut(s) 37, 155, 247
Hpy166II GTNNAC 1 cut(s) 35
Hpy188I TCNGA 1 cut(s) 30
Hpy188III TCNNGA 2 cut(s) 157, 278
Hpy8I GTNNAC 1 cut(s) 35
Hpy99I CGWCG 2 cut(s) 56, 95
HpyAV CCTTC 1 cut(s) 33
HpyF3I CTNAG 1 cut(s) 29
Hsp92I GRCGYC 1 cut(s) 54
Hsp92II CATG 2 cut(s) 259, 307
LmnI GCTCC 1 cut(s) 81
LpnPI CCDG 8 cut(s) 4, 61, 61, 71, 98, 179, 216, 228
MaeI CTAG 2 cut(s) 6, 191
MaeIII GTNAC 1 cut(s) 143
MboII GAAGA 2 cut(s) 124, 230
MluCI AATT 2 cut(s) 221, 228
MlyI GAGTC 4 cut(s) 40, 187, 188, 323
MnlI CCTC 4 cut(s) 4, 121, 144, 300
MseI TTAA 1 cut(s) 231
MslI CAYNNNNRTG 1 cut(s) 308
MspA1I CMGCKG 1 cut(s) 141
MspR9I CCNGG 1 cut(s) 86
MvaI CCWGG 1 cut(s) 86
NlaIII CATG 2 cut(s) 259, 307
NlaIV GGNNCC 1 cut(s) 83
NmuCI GTSAC 1 cut(s) 143
NspI RCATGY 1 cut(s) 259
PaeR7I CTCGAG 1 cut(s) 155
PcsI WCGNNNNNNNCGW 2 cut(s) 132, 153
PfeI GAWTC 3 cut(s) 160, 295, 328
PleI GAGTC 4 cut(s) 39, 186, 188, 322
PpsI GAGTC 4 cut(s) 39, 186, 188, 322
Psp6I CCWGG 1 cut(s) 84
PspGI CCWGG 1 cut(s) 84
PspN4I GGNNCC 1 cut(s) 83
PspPI GGNCC 1 cut(s) 68
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
RseI CAYNNNNRTG 1 cut(s) 308
SaqAI TTAA 1 cut(s) 231
Sau96I GGNCC 1 cut(s) 68
SchI GAGTC 4 cut(s) 40, 187, 188, 323
ScrFI CCNGG 1 cut(s) 86
SetI ASST 4 cut(s) 132, 237, 247, 287
Sfr274I CTCGAG 1 cut(s) 155
SlaI CTCGAG 1 cut(s) 155
SmiMI CAYNNNNRTG 1 cut(s) 308
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 2 cut(s) 221, 228
SsiI CCGC 1 cut(s) 141
SspMI CTAG 2 cut(s) 6, 191
StyD4I CCNGG 1 cut(s) 84
TaqI TCGA 4 cut(s) 126, 135, 156, 176
TasI AATT 2 cut(s) 221, 228
TatI WGTACW 1 cut(s) 120
TfiI GAWTC 3 cut(s) 160, 295, 328
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TseFI GTSAC 1 cut(s) 143
Tsp45I GTSAC 1 cut(s) 143
XceI RCATGY 1 cut(s) 259
XhoI CTCGAG 1 cut(s) 155
XspI CTAG 2 cut(s) 6, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.