Rh4DG296000

Pentatricopeptide repeat-containing protein At4g35850

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
51803322 .. 51806398
3077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG296000.1

Sequence Viewer

Length: 300 bp
ATGGAAGGCATACACCGCCAAGTCCAGATCTTCCCATATGGTGGAAGCCAAGCCAAGCTGGAGCGAGTCCATCTTGAAGTTCTTAAAGTAATGATTCAAGATCTTTCCCATTCTGCATTTCAGTTTTTGGTGATGGAAGTTCTTTTGGACATGCTAAAGGATGGAAACTATCTTGATACCTATATTGTAATTCAAACCATGAGATGCTATTTGAACTGTGATGATATTGATCGTGGTGTGCAAACCCCTGATGACTATCTGAAGTTAGGGAAGCTTCCTGCACCAGAACTCATAACATAA

Protein Analysis

99

Amino Acids

11.4

Weight (kDa)

4.95

Isoelectric Point (pI)

12.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 41
AciI CCGC 1 cut(s) 16
AcuI CTGAAG 1 cut(s) 281
AfiI CCNNNNNNNGG 1 cut(s) 41
AgsI TTSAA 4 cut(s) 77, 98, 194, 214
AluBI AGCT 2 cut(s) 58, 274
AluI AGCT 2 cut(s) 58, 274
AsuHPI GGTGA 1 cut(s) 142
BccI CCATC 3 cut(s) 78, 127, 155
BglII AGATCT 2 cut(s) 27, 100
BmsI GCATC 1 cut(s) 194
BpmI CTGGAG 1 cut(s) 80
BsaBI GATNNNNATC 2 cut(s) 228, 255
Bsc4I CCNNNNNNNGG 1 cut(s) 41
Bse8I GATNNNNATC 2 cut(s) 228, 255
BseGI GGATG 1 cut(s) 166
BseJI GATNNNNATC 2 cut(s) 228, 255
BseLI CCNNNNNNNGG 1 cut(s) 41
BsgI GTGCAG 1 cut(s) 264
BslI CCNNNNNNNGG 1 cut(s) 41
Bsp143I GATC 3 cut(s) 27, 100, 229
BspACI CCGC 1 cut(s) 16
BssMI GATC 3 cut(s) 27, 100, 229
Bst4CI ACNGT 1 cut(s) 218
BstF5I GGATG 1 cut(s) 166
BstKTI GATC 3 cut(s) 30, 103, 232
BstMBI GATC 3 cut(s) 27, 100, 229
BstMWI GCNNNNNNNGC 1 cut(s) 15
BstNSI RCATGY 1 cut(s) 154
BstX2I RGATCY 2 cut(s) 27, 100
BstYI RGATCY 2 cut(s) 27, 100
BtsCI GGATG 1 cut(s) 166
CviAII CATG 2 cut(s) 151, 199
CviJI RGCY 4 cut(s) 48, 53, 58, 274
CviKI_1 RGCY 4 cut(s) 48, 53, 58, 274
DpnI GATC 3 cut(s) 29, 102, 231
DpnII GATC 3 cut(s) 27, 100, 229
Eco57I CTGAAG 1 cut(s) 281
FaeI CATG 2 cut(s) 154, 202
FaiI YATR 8 cut(s) 11, 37, 39, 152, 183, 200, 293, 298
FatI CATG 2 cut(s) 150, 198
FauNDI CATATG 1 cut(s) 37
FokI GGATG 1 cut(s) 173
GsuI CTGGAG 1 cut(s) 80
Hin1II CATG 2 cut(s) 154, 202
HindIII AAGCTT 1 cut(s) 272
HinfI GANTC 2 cut(s) 66, 94
HphI GGTGA 1 cut(s) 142
Hpy188I TCNGA 1 cut(s) 261
Hpy188III TCNNGA 4 cut(s) 25, 74, 98, 173
HpyCH4III ACNGT 1 cut(s) 218
HpyCH4V TGCA 3 cut(s) 116, 241, 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 15
Hsp92II CATG 2 cut(s) 154, 202
Kzo9I GATC 3 cut(s) 27, 100, 229
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 4 cut(s) 38, 44, 261, 291
LweI GCATC 1 cut(s) 194
MalI GATC 3 cut(s) 29, 102, 231
MboI GATC 3 cut(s) 27, 100, 229
MboII GAAGA 1 cut(s) 22
MflI RGATCY 2 cut(s) 27, 100
MluCI AATT 1 cut(s) 189
MlyI GAGTC 1 cut(s) 75
MseI TTAA 1 cut(s) 84
MwoI GCNNNNNNNGC 1 cut(s) 15
NdeI CATATG 1 cut(s) 37
NdeII GATC 3 cut(s) 27, 100, 229
NlaIII CATG 2 cut(s) 154, 202
NspI RCATGY 1 cut(s) 154
PfeI GAWTC 1 cut(s) 94
PflMI CCANNNNNTGG 1 cut(s) 41
PleI GAGTC 1 cut(s) 74
PpsI GAGTC 1 cut(s) 74
PsuI RGATCY 2 cut(s) 27, 100
SaqAI TTAA 1 cut(s) 84
Sau3AI GATC 3 cut(s) 27, 100, 229
SchI GAGTC 1 cut(s) 75
SetI ASST 3 cut(s) 60, 182, 276
SfaNI GCATC 1 cut(s) 194
Sse9I AATT 1 cut(s) 189
SsiI CCGC 1 cut(s) 16
TaaI ACNGT 1 cut(s) 218
TasI AATT 1 cut(s) 189
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
Van91I CCANNNNNTGG 1 cut(s) 41
XceI RCATGY 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.