Rh4CG314700

Pentatricopeptide repeat-containing protein At4g35850

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
57741281 .. 57742527
1247 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG314700.1

Sequence Viewer

Length: 282 bp
ATGATATATTTCCCTCCTCTATCTTTCTTGCTCTCCTCAGACTCTAATGATTCAAGATCTTTCCCATTCTGCATTTCAGTTTTTGGTCTTGTGATGGAAGTTCTTTTGGACATGCTAAAGGATGGAAAATATCTTGATACCTATATTGTAATTCAAACCATCAGATGCTATTTGAACTGTGATGATATTGATCGTGATGTGCAAACCCCTGATGACTATCTGAAGTTAGGGAAGCTTCCTGCACCAGAACTCATAAGAAAGCTTCCTCTCTTGTGGGAATGA

Protein Analysis

93

Amino Acids

10.8

Weight (kDa)

4.49

Isoelectric Point (pI)

35.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 242
AgsI TTSAA 3 cut(s) 54, 155, 175
AluBI AGCT 2 cut(s) 235, 262
AluI AGCT 2 cut(s) 235, 262
BccI CCATC 3 cut(s) 88, 116, 167
BglII AGATCT 1 cut(s) 56
BmsI GCATC 1 cut(s) 155
BsaBI GATNNNNATC 2 cut(s) 189, 216
Bse8I GATNNNNATC 2 cut(s) 189, 216
BseGI GGATG 1 cut(s) 127
BseJI GATNNNNATC 2 cut(s) 189, 216
BseMII CTCAG 1 cut(s) 51
BseRI GAGGAG 2 cut(s) 6, 25
BsgI GTGCAG 1 cut(s) 225
Bsp143I GATC 2 cut(s) 56, 190
BspCNI CTCAG 1 cut(s) 50
BssMI GATC 2 cut(s) 56, 190
Bst4CI ACNGT 1 cut(s) 179
BstDEI CTNAG 1 cut(s) 37
BstF5I GGATG 1 cut(s) 127
BstKTI GATC 2 cut(s) 59, 193
BstMBI GATC 2 cut(s) 56, 190
BstNSI RCATGY 1 cut(s) 115
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BtsCI GGATG 1 cut(s) 127
CviAII CATG 1 cut(s) 112
CviJI RGCY 2 cut(s) 235, 262
CviKI_1 RGCY 2 cut(s) 235, 262
DdeI CTNAG 1 cut(s) 37
DpnI GATC 2 cut(s) 58, 192
DpnII GATC 2 cut(s) 56, 190
Eco57I CTGAAG 1 cut(s) 242
FaeI CATG 1 cut(s) 115
FaiI YATR 4 cut(s) 7, 113, 144, 254
FatI CATG 1 cut(s) 111
FokI GGATG 1 cut(s) 134
Hin1II CATG 1 cut(s) 115
HindIII AAGCTT 2 cut(s) 233, 260
HinfI GANTC 2 cut(s) 41, 50
Hpy188I TCNGA 3 cut(s) 40, 164, 222
Hpy188III TCNNGA 3 cut(s) 54, 134, 194
HpyCH4III ACNGT 1 cut(s) 179
HpyCH4V TGCA 3 cut(s) 72, 202, 242
HpyF3I CTNAG 1 cut(s) 37
Hsp92II CATG 1 cut(s) 115
Kzo9I GATC 2 cut(s) 56, 190
LpnPI CCDG 3 cut(s) 222, 252, 258
LweI GCATC 1 cut(s) 155
MalI GATC 2 cut(s) 58, 192
MboI GATC 2 cut(s) 56, 190
MflI RGATCY 1 cut(s) 56
MluCI AATT 1 cut(s) 150
MlyI GAGTC 1 cut(s) 35
MnlI CCTC 4 cut(s) 24, 27, 46, 276
NdeII GATC 2 cut(s) 56, 190
NlaIII CATG 1 cut(s) 115
NspI RCATGY 1 cut(s) 115
PfeI GAWTC 1 cut(s) 50
PleI GAGTC 1 cut(s) 35
PpsI GAGTC 1 cut(s) 35
PsuI RGATCY 1 cut(s) 56
Sau3AI GATC 2 cut(s) 56, 190
SchI GAGTC 1 cut(s) 35
SetI ASST 3 cut(s) 143, 237, 264
SfaNI GCATC 1 cut(s) 155
SgeI CNNG 9 cut(s) 40, 66, 101, 124, 146, 206, 221, 251, 257
Sse9I AATT 1 cut(s) 150
TaaI ACNGT 1 cut(s) 179
TasI AATT 1 cut(s) 150
TfiI GAWTC 1 cut(s) 50
XceI RCATGY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.