RchiOBHm_Chr7g0218771

Cell division cycle and apoptosis regulator protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
37009623 .. 37010975
1353 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19584

Sequence Viewer

Length: 231 bp
ATGAGTGGGATAAGCAAGAATGTTTCAGAGGAGCTGTCATATGAAAGAAGCTCTGATGATCACATGCCTCATATCTACAATATCATTAGATATGGAAAGGATGTTGTGAAACATGATCTGCAGAACTGCAAGAACTGGAATCGTTTTCTTAAGTCTACTGCTTTAAGCATGGGGAATAACCATGAGTATGATATGGCAGTTAAAGTTGAAAAGGCTAGATCCATGATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.86

Weight (kDa)

7.9

Isoelectric Point (pI)

53.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 155
AclWI GGATC 1 cut(s) 213
AflII CTTAAG 1 cut(s) 149
AgsI TTSAA 1 cut(s) 209
AluBI AGCT 2 cut(s) 34, 51
AluI AGCT 2 cut(s) 34, 51
AlwI GGATC 1 cut(s) 213
BclI TGATCA 1 cut(s) 58
BfaI CTAG 1 cut(s) 216
BfmI CTRYAG 1 cut(s) 119
BfrI CTTAAG 1 cut(s) 149
Bse1I ACTGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 106
BseNI ACTGG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 44
Bsp143I GATC 3 cut(s) 58, 115, 218
BspMAI CTGCAG 1 cut(s) 123
BspPI GGATC 1 cut(s) 213
BspTI CTTAAG 1 cut(s) 149
BsrI ACTGG 1 cut(s) 140
BssMI GATC 3 cut(s) 58, 115, 218
BstAFI CTTAAG 1 cut(s) 149
BstF5I GGATG 1 cut(s) 106
BstKTI GATC 3 cut(s) 61, 118, 221
BstMBI GATC 3 cut(s) 58, 115, 218
BstNSI RCATGY 1 cut(s) 67
BstSFI CTRYAG 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 218
BstYI RGATCY 1 cut(s) 218
BtsCI GGATG 1 cut(s) 106
CviAII CATG 5 cut(s) 64, 113, 169, 182, 223
CviJI RGCY 3 cut(s) 34, 51, 215
CviKI_1 RGCY 3 cut(s) 34, 51, 215
DpnI GATC 3 cut(s) 60, 117, 220
DpnII GATC 3 cut(s) 58, 115, 218
FaeI CATG 5 cut(s) 67, 116, 172, 185, 226
FatI CATG 5 cut(s) 63, 112, 168, 181, 222
FauNDI CATATG 1 cut(s) 40
FbaI TGATCA 1 cut(s) 58
FblI GTMKAC 1 cut(s) 155
FokI GGATG 1 cut(s) 113
FspBI CTAG 1 cut(s) 216
Hin1II CATG 5 cut(s) 67, 116, 172, 185, 226
HinfI GANTC 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 156
Hpy188I TCNGA 2 cut(s) 28, 55
Hpy8I GTNNAC 1 cut(s) 156
HpyCH4V TGCA 2 cut(s) 121, 129
Hsp92II CATG 5 cut(s) 67, 116, 172, 185, 226
Ksp22I TGATCA 1 cut(s) 58
Kzo9I GATC 3 cut(s) 58, 115, 218
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 121
MaeI CTAG 1 cut(s) 216
MalI GATC 3 cut(s) 60, 117, 220
MboI GATC 3 cut(s) 58, 115, 218
MflI RGATCY 1 cut(s) 218
MnlI CCTC 2 cut(s) 22, 78
MseI TTAA 3 cut(s) 150, 164, 201
MslI CAYNNNNRTG 1 cut(s) 186
MspCI CTTAAG 1 cut(s) 149
NdeI CATATG 1 cut(s) 40
NdeII GATC 3 cut(s) 58, 115, 218
NlaIII CATG 5 cut(s) 67, 116, 172, 185, 226
NspI RCATGY 1 cut(s) 67
PfeI GAWTC 1 cut(s) 139
PstI CTGCAG 1 cut(s) 123
PsuI RGATCY 1 cut(s) 218
RseI CAYNNNNRTG 1 cut(s) 186
SaqAI TTAA 3 cut(s) 150, 164, 201
Sau3AI GATC 3 cut(s) 58, 115, 218
SetI ASST 2 cut(s) 36, 53
SfcI CTRYAG 1 cut(s) 119
SgeI CNNG 7 cut(s) 28, 76, 125, 142, 148, 181, 194
SmiMI CAYNNNNRTG 1 cut(s) 186
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
SspMI CTAG 1 cut(s) 216
TfiI GAWTC 1 cut(s) 139
Tru1I TTAA 3 cut(s) 150, 164, 201
Tru9I TTAA 3 cut(s) 150, 164, 201
TspDTI ATGAA 1 cut(s) 57
Vha464I CTTAAG 1 cut(s) 149
XceI RCATGY 1 cut(s) 67
XmiI GTMKAC 1 cut(s) 155
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.