Rroxscaffold_3G00275310

Cell division cycle and apoptosis regulator protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
66779960 .. 66784051
4092 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00275310.1

Sequence Viewer

Length: 156 bp
ATGAGTGGGATAAGCAAGAATGCTTTAGAGGAGCTGTCATCTGAAAGAAGTTCTGATGATCACATACCCCATATATGCAATATCATTAGATATGGAAAGGATGTTGAGAAACTTGATCTGCAGAACTGCAAGAACTGGAATCGTTTTCTTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.93

Weight (kDa)

6.02

Isoelectric Point (pI)

68.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
BclI TGATCA 1 cut(s) 58
BfmI CTRYAG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 106
BseNI ACTGG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 44
BsmI GAATGC 1 cut(s) 25
Bsp143I GATC 2 cut(s) 58, 115
BspMAI CTGCAG 1 cut(s) 123
BsrI ACTGG 1 cut(s) 140
BssMI GATC 2 cut(s) 58, 115
BstF5I GGATG 1 cut(s) 106
BstKTI GATC 2 cut(s) 61, 118
BstMBI GATC 2 cut(s) 58, 115
BstSFI CTRYAG 1 cut(s) 119
BtsCI GGATG 1 cut(s) 106
CviJI RGCY 1 cut(s) 34
CviKI_1 RGCY 1 cut(s) 34
DpnI GATC 2 cut(s) 60, 117
DpnII GATC 2 cut(s) 58, 115
FaiI YATR 5 cut(s) 65, 72, 74, 76, 93
FbaI TGATCA 1 cut(s) 58
FokI GGATG 1 cut(s) 113
FspEI CC 7 cut(s) 14, 78, 81, 82, 83, 83, 121
HinfI GANTC 1 cut(s) 139
Hpy188I TCNGA 2 cut(s) 43, 55
HpyCH4V TGCA 3 cut(s) 78, 121, 129
Ksp22I TGATCA 1 cut(s) 58
Kzo9I GATC 2 cut(s) 58, 115
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 121
MalI GATC 2 cut(s) 60, 117
MboI GATC 2 cut(s) 58, 115
MluCI AATT 1 cut(s) 151
MnlI CCTC 1 cut(s) 22
MseI TTAA 2 cut(s) 150, 154
Mva1269I GAATGC 1 cut(s) 25
NdeII GATC 2 cut(s) 58, 115
PacI TTAATTAA 1 cut(s) 154
PctI GAATGC 1 cut(s) 25
PfeI GAWTC 1 cut(s) 139
PstI CTGCAG 1 cut(s) 123
SaqAI TTAA 2 cut(s) 150, 154
Sau3AI GATC 2 cut(s) 58, 115
SetI ASST 1 cut(s) 36
SfcI CTRYAG 1 cut(s) 119
SgeI CNNG 4 cut(s) 28, 125, 142, 148
Sse9I AATT 1 cut(s) 151
TasI AATT 1 cut(s) 151
TfiI GAWTC 1 cut(s) 139
Tru1I TTAA 2 cut(s) 150, 154
Tru9I TTAA 2 cut(s) 150, 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.