Rmu_sc0020639.1_g000001

Cell division cycle and apoptosis regulator protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020639.1
Physical Location & Seq
Reverse (-)
1467 .. 2029
563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020639.1_g000001.1.cds

Sequence Viewer

Length: 264 bp
atgagtgggataagcaagaatgctttagaggagctgtcatctgaaagaagttctgatgatcgcataccccatatatgcaatatcattagatatggaaaggatgttgcgaaacttgatctgcagaactgcaagaactggaatcgttttcttaagatacactacgataggattgggaaagatggattctttagccataacgagattattgtcatattcgtcccagatttgtctgagtgtcttccttcattggatactggcagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.93

Weight (kDa)

5.84

Isoelectric Point (pI)

60.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 149
AluBI AGCT 1 cut(s) 34
AluI AGCT 1 cut(s) 34
BbsI GAAGAC 1 cut(s) 230
BccI CCATC 1 cut(s) 173
BciVI GTATCC 1 cut(s) 244
BfmI CTRYAG 1 cut(s) 119
BfrI CTTAAG 1 cut(s) 149
BfuI GTATCC 1 cut(s) 244
BpiI GAAGAC 1 cut(s) 230
Bse1I ACTGG 2 cut(s) 140, 259
BseGI GGATG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 222
BseNI ACTGG 2 cut(s) 140, 259
BseRI GAGGAG 1 cut(s) 44
BslFI GGGAC 1 cut(s) 203
BsmFI GGGAC 1 cut(s) 203
BsmI GAATGC 1 cut(s) 25
Bsp143I GATC 2 cut(s) 58, 115
BspCNI CTCAG 1 cut(s) 223
BspMAI CTGCAG 1 cut(s) 123
BspTI CTTAAG 1 cut(s) 149
BsrI ACTGG 2 cut(s) 140, 259
BssMI GATC 2 cut(s) 58, 115
BstAFI CTTAAG 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 231
BstF5I GGATG 1 cut(s) 106
BstKTI GATC 2 cut(s) 61, 118
BstMBI GATC 2 cut(s) 58, 115
BstSFI CTRYAG 1 cut(s) 119
BstV2I GAAGAC 1 cut(s) 230
BsuI GTATCC 1 cut(s) 244
BtsCI GGATG 1 cut(s) 106
CviJI RGCY 2 cut(s) 34, 192
CviKI_1 RGCY 2 cut(s) 34, 192
DdeI CTNAG 1 cut(s) 231
DpnI GATC 2 cut(s) 60, 117
DpnII GATC 2 cut(s) 58, 115
FaiI YATR 7 cut(s) 65, 72, 74, 76, 93, 195, 212
FaqI GGGAC 1 cut(s) 203
FokI GGATG 1 cut(s) 113
HinfI GANTC 2 cut(s) 139, 183
Hpy188I TCNGA 3 cut(s) 43, 55, 232
HpyAV CCTTC 1 cut(s) 252
HpyCH4V TGCA 3 cut(s) 78, 121, 129
HpyF3I CTNAG 1 cut(s) 231
Kzo9I GATC 2 cut(s) 58, 115
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 3 cut(s) 121, 234, 240
MalI GATC 2 cut(s) 60, 117
MboI GATC 2 cut(s) 58, 115
MboII GAAGA 1 cut(s) 230
MnlI CCTC 1 cut(s) 22
MseI TTAA 2 cut(s) 150, 262
MspCI CTTAAG 1 cut(s) 149
Mva1269I GAATGC 1 cut(s) 25
NdeII GATC 2 cut(s) 58, 115
PctI GAATGC 1 cut(s) 25
PfeI GAWTC 2 cut(s) 139, 183
PstI CTGCAG 1 cut(s) 123
SaqAI TTAA 2 cut(s) 150, 262
Sau3AI GATC 2 cut(s) 58, 115
SetI ASST 1 cut(s) 36
SfcI CTRYAG 1 cut(s) 119
SgeI CNNG 6 cut(s) 28, 125, 142, 148, 211, 233
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
TfiI GAWTC 2 cut(s) 139, 183
Tru1I TTAA 2 cut(s) 150, 262
Tru9I TTAA 2 cut(s) 150, 262
TspDTI ATGAA 1 cut(s) 234
Vha464I CTTAAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.