RLG00000002741

Cell division cycle and apoptosis regulator protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0003969
Physical Location & Seq
Reverse (-)
38952904 .. 38955690
2787 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000002741

Sequence Viewer

Length: 384 bp
ATGCTACATGGTCGGGGCCTCCAAAGAAGACAATGCTATGAATTCAATTGTCACTATGCTGTTGGGCCTGTTTCGTGCAAACAGCTTAATATATTACATGATTCGTGGTCAAGGAACAATCAAATTGTATGTGGTGTACAATGTGTTGGAGTTGCTAATCATGACTATCCTTCTTTTCTATCCCTCTTCCAAATTATCTTGATGAGTGGGATAAGCAAGAATGTTTTAGAGGAGCTGTCATTTGAAAGAAGCTCTGATGATCGCATACCTCATATCTGCAATATCATTAGCTCTTTAATTCAAACTGCAATAAGATATGGAAAGGATGTTGCGAAGCATGATATGCAAAACTGCAAGAACTGGAATCGTTTTCTTAACGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBC1

Protein Analysis

128

Amino Acids

14.6

Weight (kDa)

8.52

Isoelectric Point (pI)

54.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DBC1 PF14443 97 - 127 6.9e-06 DBC1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 41
AfaI GTAC 1 cut(s) 138
AgsI TTSAA 3 cut(s) 46, 245, 302
AluBI AGCT 4 cut(s) 85, 235, 252, 291
AluI AGCT 4 cut(s) 85, 235, 252, 291
AoxI GGCC 2 cut(s) 16, 65
ApoI RAATTY 1 cut(s) 41
AspS9I GGNCC 2 cut(s) 16, 65
BbsI GAAGAC 1 cut(s) 34
BmgT120I GGNCC 2 cut(s) 16, 65
BmiI GGNNCC 1 cut(s) 17
BpiI GAAGAC 1 cut(s) 34
Bse1I ACTGG 1 cut(s) 365
BseGI GGATG 1 cut(s) 331
BseNI ACTGG 1 cut(s) 365
BseRI GAGGAG 1 cut(s) 245
BshFI GGCC 2 cut(s) 18, 67
BsnI GGCC 2 cut(s) 18, 67
Bsp1407I TGTACA 1 cut(s) 136
Bsp143I GATC 1 cut(s) 259
BspANI GGCC 2 cut(s) 18, 67
BspHI TCATGA 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 17
BsrGI TGTACA 1 cut(s) 136
BsrI ACTGG 1 cut(s) 365
BssMI GATC 1 cut(s) 259
Bst6I CTCTTC 1 cut(s) 191
BstAPI GCANNNNNTGC 1 cut(s) 343
BstAUI TGTACA 1 cut(s) 136
BstF5I GGATG 1 cut(s) 331
BstKTI GATC 1 cut(s) 262
BstMBI GATC 1 cut(s) 259
BstMWI GCNNNNNNNGC 1 cut(s) 343
BstV2I GAAGAC 1 cut(s) 34
BsuRI GGCC 2 cut(s) 18, 67
BtsCI GGATG 1 cut(s) 331
CciI TCATGA 1 cut(s) 160
Cfr13I GGNCC 2 cut(s) 16, 65
Csp6I GTAC 1 cut(s) 137
CviAII CATG 4 cut(s) 8, 98, 161, 338
CviJI RGCY 6 cut(s) 18, 67, 85, 235, 252, 291
CviKI_1 RGCY 6 cut(s) 18, 67, 85, 235, 252, 291
CviQI GTAC 1 cut(s) 137
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
Eam1104I CTCTTC 1 cut(s) 191
EarI CTCTTC 1 cut(s) 191
EcoO109I RGGNCCY 1 cut(s) 16
EcoRI GAATTC 1 cut(s) 41
FaeI CATG 4 cut(s) 11, 101, 164, 341
FatI CATG 4 cut(s) 7, 97, 160, 337
FokI GGATG 1 cut(s) 338
HaeIII GGCC 2 cut(s) 18, 67
Hin1II CATG 4 cut(s) 11, 101, 164, 341
HinfI GANTC 2 cut(s) 101, 364
Hpy166II GTNNAC 1 cut(s) 137
Hpy188I TCNGA 1 cut(s) 256
Hpy188III TCNNGA 2 cut(s) 161, 199
Hpy8I GTNNAC 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 180
HpyCH4IV ACGT 1 cut(s) 378
HpyCH4V TGCA 5 cut(s) 78, 279, 308, 346, 354
HpyF10VI GCNNNNNNNGC 1 cut(s) 343
HpySE526I ACGT 1 cut(s) 378
Hsp92II CATG 4 cut(s) 11, 101, 164, 341
Kzo9I GATC 1 cut(s) 259
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 2 cut(s) 81, 346
MaeII ACGT 1 cut(s) 378
MaeIII GTNAC 1 cut(s) 50
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MboII GAAGA 2 cut(s) 39, 178
MfeI CAATTG 1 cut(s) 46
MluCI AATT 5 cut(s) 41, 46, 123, 192, 297
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 4 cut(s) 29, 194, 223, 279
MseI TTAA 3 cut(s) 87, 296, 375
MunI CAATTG 1 cut(s) 46
MwoI GCNNNNNNNGC 1 cut(s) 343
NdeII GATC 1 cut(s) 259
NlaIII CATG 4 cut(s) 11, 101, 164, 341
NlaIV GGNNCC 1 cut(s) 17
NmuCI GTSAC 1 cut(s) 50
PagI TCATGA 1 cut(s) 160
PfeI GAWTC 2 cut(s) 101, 364
PspN4I GGNNCC 1 cut(s) 17
PspPI GGNCC 2 cut(s) 16, 65
RsaI GTAC 1 cut(s) 138
RsaNI GTAC 1 cut(s) 137
SaqAI TTAA 3 cut(s) 87, 296, 375
Sau3AI GATC 1 cut(s) 259
Sau96I GGNCC 2 cut(s) 16, 65
SetI ASST 6 cut(s) 87, 237, 254, 271, 293, 381
Sse9I AATT 5 cut(s) 41, 46, 123, 192, 297
TaiI ACGT 1 cut(s) 381
TasI AATT 5 cut(s) 41, 46, 123, 192, 297
TatI WGTACW 1 cut(s) 136
TfiI GAWTC 2 cut(s) 101, 364
Tru1I TTAA 3 cut(s) 87, 296, 375
Tru9I TTAA 3 cut(s) 87, 296, 375
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 54
XapI RAATTY 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.