Rh1AG340400

Cell division cycle and apoptosis regulator protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0003969
Physical Location & Seq
Forward (+)
57587595 .. 57588215
621 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG340400.1

Sequence Viewer

Length: 213 bp
ATGACAATTAGTGGTCCATGGAATTCCACTGATGGTGGTGATCCATCAGTTGATGATAGCTCTTTAATTCAAACTGCAATAAGATATGGAAAGGATGTTGTGAAACATGATCTGCAGAACTGCAAGAACTGGAATCGTTTTCTTAAGGATGAGCTTGTTGGCAGCTTTACCTTCAACCCTTTGCTGAAAGCATTGATAAATGAATGGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBC1

Protein Analysis

70

Amino Acids

7.91

Weight (kDa)

5.03

Isoelectric Point (pI)

16.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DBC1 PF14443 1 - 48 7.6e-15 DBC1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 35
AcsI RAATTY 1 cut(s) 22
AflII CTTAAG 1 cut(s) 143
AgsI TTSAA 2 cut(s) 71, 175
AluBI AGCT 3 cut(s) 60, 154, 165
AluI AGCT 3 cut(s) 60, 154, 165
AlwI GGATC 1 cut(s) 35
ApeKI GCWGC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 22
AspS9I GGNCC 1 cut(s) 14
AsuHPI GGTGA 1 cut(s) 50
AvaII GGWCC 1 cut(s) 14
BbvI GCAGC 1 cut(s) 174
BccI CCATC 2 cut(s) 26, 52
BfmI CTRYAG 1 cut(s) 113
BfrI CTTAAG 1 cut(s) 143
BisI GCNGC 1 cut(s) 163
BlsI GCNGC 1 cut(s) 164
Bme18I GGWCC 1 cut(s) 14
BmgT120I GGNCC 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 17
Bse1I ACTGG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 17
BseGI GGATG 2 cut(s) 100, 154
BseNI ACTGG 1 cut(s) 134
BseXI GCAGC 1 cut(s) 174
Bsp143I GATC 2 cut(s) 40, 109
Bsp19I CCATGG 1 cut(s) 17
BspMAI CTGCAG 1 cut(s) 117
BspPI GGATC 1 cut(s) 35
BspTI CTTAAG 1 cut(s) 143
BsrI ACTGG 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 17
BssMI GATC 2 cut(s) 40, 109
BssT1I CCWWGG 1 cut(s) 17
BstAFI CTTAAG 1 cut(s) 143
BstDSI CCRYGG 1 cut(s) 17
BstF5I GGATG 2 cut(s) 100, 154
BstKTI GATC 2 cut(s) 43, 112
BstMBI GATC 2 cut(s) 40, 109
BstSFI CTRYAG 1 cut(s) 113
BstV1I GCAGC 1 cut(s) 174
BtgI CCRYGG 1 cut(s) 17
BtsCI GGATG 2 cut(s) 100, 154
BtsIMutI CAGTG 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 14
CviAII CATG 2 cut(s) 18, 107
CviJI RGCY 4 cut(s) 60, 154, 165, 208
CviKI_1 RGCY 4 cut(s) 60, 154, 165, 208
DpnI GATC 2 cut(s) 42, 111
DpnII GATC 2 cut(s) 40, 109
Eco130I CCWWGG 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 14
EcoRI GAATTC 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 17
ErhI CCWWGG 1 cut(s) 17
FaeI CATG 2 cut(s) 21, 110
FaiI YATR 3 cut(s) 19, 87, 108
FatI CATG 2 cut(s) 17, 106
Fnu4HI GCNGC 1 cut(s) 163
FokI GGATG 2 cut(s) 107, 161
Fsp4HI GCNGC 1 cut(s) 163
GluI GCNGC 1 cut(s) 163
Hin1II CATG 2 cut(s) 21, 110
HinfI GANTC 1 cut(s) 133
HphI GGTGA 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 181
HpyCH4V TGCA 3 cut(s) 77, 115, 123
Hsp92II CATG 2 cut(s) 21, 110
Kzo9I GATC 2 cut(s) 40, 109
LpnPI CCDG 1 cut(s) 115
Lsp1109I GCAGC 1 cut(s) 174
MalI GATC 2 cut(s) 42, 111
MboI GATC 2 cut(s) 40, 109
MluCI AATT 3 cut(s) 6, 22, 66
MseI TTAA 3 cut(s) 65, 144, 211
MspCI CTTAAG 1 cut(s) 143
NcoI CCATGG 1 cut(s) 17
NdeII GATC 2 cut(s) 40, 109
NlaIII CATG 2 cut(s) 21, 110
PfeI GAWTC 1 cut(s) 133
PkrI GCNGC 1 cut(s) 164
PspPI GGNCC 1 cut(s) 14
PstI CTGCAG 1 cut(s) 117
SaqAI TTAA 3 cut(s) 65, 144, 211
SatI GCNGC 1 cut(s) 163
Sau3AI GATC 2 cut(s) 40, 109
Sau96I GGNCC 1 cut(s) 14
SetI ASST 4 cut(s) 62, 156, 167, 173
SfcI CTRYAG 1 cut(s) 113
SgeI CNNG 5 cut(s) 30, 119, 136, 142, 167
SinI GGWCC 1 cut(s) 14
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
Sse9I AATT 3 cut(s) 6, 22, 66
StyI CCWWGG 1 cut(s) 17
TasI AATT 3 cut(s) 6, 22, 66
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 3 cut(s) 65, 144, 211
Tru9I TTAA 3 cut(s) 65, 144, 211
TscAI CASTG 1 cut(s) 34
TseI GCWGC 1 cut(s) 162
TspRI CASTG 1 cut(s) 34
Vha464I CTTAAG 1 cut(s) 143
VpaK11BI GGWCC 1 cut(s) 14
XapI RAATTY 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.