Rh7CG433800

Cell division cycle and apoptosis regulator protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
56789975 .. 56790710
736 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG433800.1

Sequence Viewer

Length: 219 bp
ATGAGTGGGATAAGCAAGAATGTTTCAGAGGAGCTGTCATATGAAAGAAGCTCTGATGATCGCATGCCTCATATCTACAATATCATTAGATATGGAAAGGATGTTGTGAAACATGATCTACAGAACTGCAAGAACTGGAATCGTTTTCTTAAGGATGAGCTTGTTGGCAGCTTTACCTTCAACCCTTTGCTGAAAGCATTGATAAATGAATGGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.52

Weight (kDa)

6.71

Isoelectric Point (pI)

44.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 149
AgsI TTSAA 1 cut(s) 181
AluBI AGCT 4 cut(s) 34, 51, 160, 171
AluI AGCT 4 cut(s) 34, 51, 160, 171
ApeKI GCWGC 1 cut(s) 168
BbvI GCAGC 1 cut(s) 180
BfmI CTRYAG 1 cut(s) 119
BfrI CTTAAG 1 cut(s) 149
BisI GCNGC 1 cut(s) 169
BlsI GCNGC 1 cut(s) 170
Bse1I ACTGG 1 cut(s) 140
BseGI GGATG 2 cut(s) 106, 160
BseNI ACTGG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 44
BseXI GCAGC 1 cut(s) 180
Bsp143I GATC 2 cut(s) 58, 115
BspTI CTTAAG 1 cut(s) 149
BsrI ACTGG 1 cut(s) 140
BssMI GATC 2 cut(s) 58, 115
BstAFI CTTAAG 1 cut(s) 149
BstC8I GCNNGC 1 cut(s) 65
BstF5I GGATG 2 cut(s) 106, 160
BstKTI GATC 2 cut(s) 61, 118
BstMBI GATC 2 cut(s) 58, 115
BstNSI RCATGY 1 cut(s) 67
BstSFI CTRYAG 1 cut(s) 119
BstV1I GCAGC 1 cut(s) 180
BtsCI GGATG 2 cut(s) 106, 160
Cac8I GCNNGC 1 cut(s) 65
CviAII CATG 2 cut(s) 64, 113
CviJI RGCY 5 cut(s) 34, 51, 160, 171, 214
CviKI_1 RGCY 5 cut(s) 34, 51, 160, 171, 214
DpnI GATC 2 cut(s) 60, 117
DpnII GATC 2 cut(s) 58, 115
FaeI CATG 2 cut(s) 67, 116
FaiI YATR 6 cut(s) 40, 42, 65, 72, 93, 114
FatI CATG 2 cut(s) 63, 112
FauNDI CATATG 1 cut(s) 40
Fnu4HI GCNGC 1 cut(s) 169
FokI GGATG 2 cut(s) 113, 167
Fsp4HI GCNGC 1 cut(s) 169
GluI GCNGC 1 cut(s) 169
Hin1II CATG 2 cut(s) 67, 116
HinfI GANTC 1 cut(s) 139
Hpy188I TCNGA 2 cut(s) 28, 55
HpyAV CCTTC 1 cut(s) 187
HpyCH4V TGCA 1 cut(s) 129
Hsp92II CATG 2 cut(s) 67, 116
Kzo9I GATC 2 cut(s) 58, 115
LmnI GCTCC 1 cut(s) 31
LpnPI CCDG 1 cut(s) 121
Lsp1109I GCAGC 1 cut(s) 180
MalI GATC 2 cut(s) 60, 117
MboI GATC 2 cut(s) 58, 115
MnlI CCTC 2 cut(s) 22, 78
MseI TTAA 2 cut(s) 150, 217
MspCI CTTAAG 1 cut(s) 149
NdeI CATATG 1 cut(s) 40
NdeII GATC 2 cut(s) 58, 115
NlaIII CATG 2 cut(s) 67, 116
NspI RCATGY 1 cut(s) 67
PaeI GCATGC 1 cut(s) 67
PfeI GAWTC 1 cut(s) 139
PkrI GCNGC 1 cut(s) 170
SaqAI TTAA 2 cut(s) 150, 217
SatI GCNGC 1 cut(s) 169
Sau3AI GATC 2 cut(s) 58, 115
SetI ASST 5 cut(s) 36, 53, 162, 173, 179
SfcI CTRYAG 1 cut(s) 119
SgeI CNNG 6 cut(s) 28, 76, 125, 142, 148, 173
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
SphI GCATGC 1 cut(s) 67
TfiI GAWTC 1 cut(s) 139
Tru1I TTAA 2 cut(s) 150, 217
Tru9I TTAA 2 cut(s) 150, 217
TseI GCWGC 1 cut(s) 168
TspDTI ATGAA 1 cut(s) 57
Vha464I CTTAAG 1 cut(s) 149
XceI RCATGY 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.