Rh6DG120600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
16606346 .. 16607908
1563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG120600.1

Sequence Viewer

Length: 321 bp
ATGAGATGTTTAATTTGTTTCATTAGTGTTGATGTTTCTTATAATAATATCGTTCTTTTGATGAATACTGCTTTTCAAGGTCTGTGGATCTTGCAAAGTTTATTAGCCTTTGATGAAGATGTTGTTGAGCTTGACTTACTGAATGAGCTAGGGAAAATGCAAAGATTAGCCTTTTCGACTTTCCAGAGGATGGATCAGGAGATATGCATCAATAGTTTTTTTAGTATTAGATTCATTTGTACAATTCCAGTTTCAGTAAGCAAGCCAGTGGCTTTGCAAGTTCTCTTTCACAAACATGGCTTTCAAATCCCCAATCGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

106

Amino Acids

12.24

Weight (kDa)

6.03

Isoelectric Point (pI)

41.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 42
AccB7I CCANNNNNTGG 1 cut(s) 190
AclWI GGATC 2 cut(s) 95, 201
AfaI GTAC 1 cut(s) 241
AfiI CCNNNNNNNGG 1 cut(s) 190
AgsI TTSAA 2 cut(s) 77, 305
AluBI AGCT 2 cut(s) 130, 148
AluI AGCT 2 cut(s) 130, 148
AlwI GGATC 2 cut(s) 95, 201
BccI CCATC 1 cut(s) 184
BfaI CTAG 1 cut(s) 149
BmsI GCATC 1 cut(s) 216
Bsa29I ATCGAT 1 cut(s) 316
BsaBI GATNNNNATC 1 cut(s) 206
Bsc4I CCNNNNNNNGG 1 cut(s) 190
Bse1I ACTGG 2 cut(s) 248, 266
Bse8I GATNNNNATC 1 cut(s) 206
BseCI ATCGAT 1 cut(s) 316
BseGI GGATG 1 cut(s) 195
BseJI GATNNNNATC 1 cut(s) 206
BseLI CCNNNNNNNGG 1 cut(s) 190
BseNI ACTGG 2 cut(s) 248, 266
BshVI ATCGAT 1 cut(s) 316
BslI CCNNNNNNNGG 1 cut(s) 190
Bsp1407I TGTACA 1 cut(s) 239
Bsp143I GATC 2 cut(s) 87, 193
BspDI ATCGAT 1 cut(s) 316
BspPI GGATC 2 cut(s) 95, 201
BsrGI TGTACA 1 cut(s) 239
BsrI ACTGG 2 cut(s) 248, 266
BssMI GATC 2 cut(s) 87, 193
BstAUI TGTACA 1 cut(s) 239
BstC8I GCNNGC 1 cut(s) 263
BstF5I GGATG 1 cut(s) 195
BstKTI GATC 2 cut(s) 90, 196
BstMBI GATC 2 cut(s) 87, 193
BstX2I RGATCY 1 cut(s) 87
BstYI RGATCY 1 cut(s) 87
Bsu15I ATCGAT 1 cut(s) 316
BsuTUI ATCGAT 1 cut(s) 316
BtsCI GGATG 1 cut(s) 195
BtsIMutI CAGTG 1 cut(s) 273
Cac8I GCNNGC 1 cut(s) 263
ClaI ATCGAT 1 cut(s) 316
Csp6I GTAC 1 cut(s) 240
CspCI CAANNNNNGTGG 2 cut(s) 65, 100
CviAII CATG 1 cut(s) 296
CviJI RGCY 7 cut(s) 107, 130, 148, 170, 265, 272, 300
CviKI_1 RGCY 7 cut(s) 107, 130, 148, 170, 265, 272, 300
CviQI GTAC 1 cut(s) 240
DpnI GATC 2 cut(s) 89, 195
DpnII GATC 2 cut(s) 87, 193
EcoT22I ATGCAT 1 cut(s) 209
FaeI CATG 1 cut(s) 299
FaiI YATR 3 cut(s) 42, 205, 297
FatI CATG 1 cut(s) 295
FokI GGATG 1 cut(s) 202
FspBI CTAG 1 cut(s) 149
Hin1II CATG 1 cut(s) 299
HinfI GANTC 1 cut(s) 231
Hpy188III TCNNGA 2 cut(s) 184, 197
HpyCH4V TGCA 4 cut(s) 94, 160, 207, 277
Hsp92II CATG 1 cut(s) 299
Kzo9I GATC 2 cut(s) 87, 193
LpnPI CCDG 4 cut(s) 182, 197, 261, 279
LweI GCATC 1 cut(s) 216
MaeI CTAG 1 cut(s) 149
MalI GATC 2 cut(s) 89, 195
MboI GATC 2 cut(s) 87, 193
MboII GAAGA 1 cut(s) 128
MflI RGATCY 1 cut(s) 87
MluCI AATT 2 cut(s) 12, 243
MnlI CCTC 1 cut(s) 180
Mph1103I ATGCAT 1 cut(s) 209
MseI TTAA 1 cut(s) 11
MslI CAYNNNNRTG 1 cut(s) 294
NdeII GATC 2 cut(s) 87, 193
NlaIII CATG 1 cut(s) 299
NsiI ATGCAT 1 cut(s) 209
PfeI GAWTC 1 cut(s) 231
PflMI CCANNNNNTGG 1 cut(s) 190
PsiI TTATAA 1 cut(s) 42
PsuI RGATCY 1 cut(s) 87
RsaI GTAC 1 cut(s) 241
RsaNI GTAC 1 cut(s) 240
RseI CAYNNNNRTG 1 cut(s) 294
SaqAI TTAA 1 cut(s) 11
Sau3AI GATC 2 cut(s) 87, 193
SetI ASST 3 cut(s) 82, 132, 150
SfaNI GCATC 1 cut(s) 216
SmiMI CAYNNNNRTG 1 cut(s) 294
Sse9I AATT 2 cut(s) 12, 243
SspMI CTAG 1 cut(s) 149
TaqI TCGA 2 cut(s) 176, 316
TasI AATT 2 cut(s) 12, 243
TatI WGTACW 1 cut(s) 239
TfiI GAWTC 1 cut(s) 231
Tru1I TTAA 1 cut(s) 11
Tru9I TTAA 1 cut(s) 11
TscAI CASTG 1 cut(s) 273
TspDTI ATGAA 4 cut(s) 10, 77, 129, 223
TspRI CASTG 1 cut(s) 273
Van91I CCANNNNNTGG 1 cut(s) 190
XspI CTAG 1 cut(s) 149
Zsp2I ATGCAT 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.