RLG00000015280

Belongs to the glutathione peroxidase family

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Forward (+)
63953381 .. 63954144
764 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000015280

Sequence Viewer

Length: 339 bp
ATGTTTCTACTCAGTCTAAGTGTTCAACCTTGGTTTAACATAATCCAACTACAAGGAATTGAACATTTTTTTGCAGGACAAGACGTTTCCTGGAATGAGGAGATTCAGGAAGTTGCATGTACGAAGTTGAAAGCTGAATTTCCAATCTTTGACAAGGATGAGGCTTCCCTTTACAAGGTCTTAAAATTGGAGAAAGGTGGTCTCTTTGGAAATGGCATCAAATGGAACTTTACCAAGTTTTTGGTAAACAAAGAAGAGAAGGTTGTGGAGAGATATGCTCCCGTGACAGCACCTCTCAAAATTGAGAAAGACATCCAGAATCTATTGGAATCTTCTTGA

Protein Analysis

113

Amino Acids

12.91

Weight (kDa)

5.19

Isoelectric Point (pI)

46.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 137
AfaI GTAC 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 175
AgsI TTSAA 3 cut(s) 26, 62, 130
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
Alw26I GTCTC 1 cut(s) 206
ApoI RAATTY 1 cut(s) 137
BciT130I CCWGG 1 cut(s) 91
BcoDI GTCTC 1 cut(s) 206
Bme1390I CCNGG 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 91
BmsI GCATC 1 cut(s) 225
BplI GAGNNNNNCTC 2 cut(s) 262, 294
BsaI GGTCTC 1 cut(s) 206
BsaJI CCNNGG 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 175
BseBI CCWGG 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 29
BseGI GGATG 2 cut(s) 163, 312
BseLI CCNNNNNNNGG 1 cut(s) 175
BseMII CTCAG 1 cut(s) 25
BseRI GAGGAG 1 cut(s) 113
BslI CCNNNNNNNGG 1 cut(s) 175
BsmAI GTCTC 1 cut(s) 206
Bso31I GGTCTC 1 cut(s) 206
BspCNI CTCAG 1 cut(s) 24
BspTNI GGTCTC 1 cut(s) 206
BssECI CCNNGG 1 cut(s) 29
BssT1I CCWWGG 1 cut(s) 29
Bst2UI CCWGG 1 cut(s) 91
Bst6I CTCTTC 1 cut(s) 249
BstDEI CTNAG 2 cut(s) 11, 17
BstENI CCTNNNNNAGG 1 cut(s) 173
BstF5I GGATG 2 cut(s) 163, 312
BstMAI GTCTC 1 cut(s) 206
BstNI CCWGG 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 89
BstXI CCANNNNNNTGG 1 cut(s) 241
BtsCI GGATG 2 cut(s) 163, 312
Csp6I GTAC 1 cut(s) 120
CviAII CATG 1 cut(s) 117
CviJI RGCY 2 cut(s) 134, 164
CviKI_1 RGCY 2 cut(s) 134, 164
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 2 cut(s) 11, 17
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
Eco130I CCWWGG 1 cut(s) 29
Eco31I GGTCTC 1 cut(s) 206
EcoNI CCTNNNNNAGG 1 cut(s) 173
EcoRII CCWGG 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 29
ErhI CCWWGG 1 cut(s) 29
FaeI CATG 1 cut(s) 120
FaiI YATR 3 cut(s) 41, 118, 276
FatI CATG 1 cut(s) 116
FokI GGATG 2 cut(s) 170, 299
Hin1II CATG 1 cut(s) 120
HinfI GANTC 3 cut(s) 103, 319, 329
Hpy166II GTNNAC 1 cut(s) 247
Hpy188III TCNNGA 3 cut(s) 107, 316, 336
Hpy8I GTNNAC 1 cut(s) 247
HpyAV CCTTC 1 cut(s) 253
HpyCH4IV ACGT 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 74, 116
HpyF3I CTNAG 2 cut(s) 11, 17
HpySE526I ACGT 1 cut(s) 84
Hsp92II CATG 1 cut(s) 120
LmnI GCTCC 1 cut(s) 283
LpnPI CCDG 5 cut(s) 60, 76, 92, 103, 329
LweI GCATC 1 cut(s) 225
MaeII ACGT 1 cut(s) 84
MaeIII GTNAC 1 cut(s) 283
MboII GAAGA 2 cut(s) 266, 324
MluCI AATT 4 cut(s) 57, 137, 185, 300
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 3 cut(s) 91, 154, 303
MseI TTAA 2 cut(s) 36, 182
MspR9I CCNGG 1 cut(s) 91
MvaI CCWGG 1 cut(s) 91
NlaIII CATG 1 cut(s) 120
NmuCI GTSAC 1 cut(s) 283
NspI RCATGY 1 cut(s) 120
PfeI GAWTC 3 cut(s) 103, 319, 329
PfoI TCCNGGA 1 cut(s) 89
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 36, 182
ScrFI CCNGG 1 cut(s) 91
SetI ASST 7 cut(s) 31, 87, 136, 180, 199, 264, 295
SfaNI GCATC 1 cut(s) 225
Sse9I AATT 4 cut(s) 57, 137, 185, 300
StyD4I CCNGG 1 cut(s) 89
StyI CCWWGG 1 cut(s) 29
TaiI ACGT 1 cut(s) 87
TasI AATT 4 cut(s) 57, 137, 185, 300
TfiI GAWTC 3 cut(s) 103, 319, 329
Tru1I TTAA 2 cut(s) 36, 182
Tru9I TTAA 2 cut(s) 36, 182
TseFI GTSAC 1 cut(s) 283
Tsp45I GTSAC 1 cut(s) 283
XagI CCTNNNNNAGG 1 cut(s) 173
XapI RAATTY 1 cut(s) 137
XceI RCATGY 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.