Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr7

Orthogroup ID

OG0005528

Physical Location & Seq

Genomic Coordinates Reverse (-)

29618975 .. 29619851

Gene Structure 877 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000033614

Sequence Viewer

CDS Protein Promoter (2k)

Length: 441 bp

ATGGGGATATGGGATACCATTTCTTGGACAACCGATTCACTGAAACGGAACGCGCCGTATCTAACGGCTTCGCTCAAGCGCATCGCACCCGATGGAACAGCTGTCAAGAACGCGTGCTCCACCGCTTACTGTTATGGCTCCGCCGTCAGGGATAATGTGATCCCCTACTTTCCAAACGAGGAAGTGCGGTCCAAGATCTACCAAATTGCCCCGATCCTCCTTAAAAACGCAACCTATGAGGGCCTAAAATTCGTTCCAGGTGGAATTGCATTTTATAACTTTGCTGTCAGATGCTACCGTGACTATAACGATTCTAATAAACAAGAAGTGGATGTCAAAGAATTGCAGGCTAAAGTATCGAGACGAGAGGAAGAATTCGGTGAATTCCGGGAATCCCCCAGCATAAGCAACGTTCAGTGTAAACTGAGAGCAAAGATGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

147

Amino Acids

16.61

Weight (kDa)

8.86

Isoelectric Point (pI)

48.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005528)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g20890
malus_domestica	MD03G1219600.v1.1 MD11G1237800.v1.1
prunus_persica	Prupe.4G189400_v2.0.a1 Prupe.4G189400_v2.0.a1 Prupe.4G189500_v2.0.a1
pyrus_communis	pycom03g16890 pycom11g20910 pycom11g20920
rosa_chinensis	RchiOBHm_Chr5g0035261 RchiOBHm_Chr5g0035271 RchiOBHm_Chr5g0035311
rosa_laevigata	RLG00000033614 RLG00000033616
rosa_multiflora	Rmu_sc0007948.1_g000004 Rmu_sc0008116.1_g000006
rosa_roxburghii	Rroxscaffold_1G00045090 Rroxscaffold_1G00045100 Rroxscaffold_1G00045120
rosa_samantha	Rh5AG244000 Rh5AG244100 Rh5AG244200 Rh5BG243700 Rh5CG275200 Rh5CG275400 Rh5CG275500 Rh5DG252700
rosa_wichuraiana	Rw5G022290 Rw5G022300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	276
AccB7I	CCANNNNNTGG	1 cut(s)	24
AccII	CGCG	2 cut(s)	53, 113
AciI	CCGC	3 cut(s)	123, 141, 187
AclI	AACGTT	1 cut(s)	411
AclWI	GGATC	2 cut(s)	154, 208
AcsI	RAATTY	3 cut(s)	248, 374, 383
AfiI	CCNNNNNNNGG	2 cut(s)	24, 147
AflIII	ACRYGT	1 cut(s)	111
AjnI	CCWGG	1 cut(s)	256
AloI	GAACNNNNNNTCC	2 cut(s)	101, 133
AluBI	AGCT	1 cut(s)	101
AluI	AGCT	1 cut(s)	101
Alw21I	GWGCWC	1 cut(s)	119
Alw26I	GTCTC	1 cut(s)	355
AlwI	GGATC	2 cut(s)	154, 208
AoxI	GGCC	1 cut(s)	241
ApoI	RAATTY	3 cut(s)	248, 374, 383
AspLEI	GCGC	2 cut(s)	55, 81
AspS9I	GGNCC	2 cut(s)	189, 241
AsuC2I	CCSGG	1 cut(s)	389
AsuHPI	GGTGA	1 cut(s)	392
AvaII	GGWCC	1 cut(s)	189
Bbv12I	GWGCWC	1 cut(s)	119
BccI	CCATC	1 cut(s)	86
BceAI	ACGGC	3 cut(s)	40, 81, 128
BciT130I	CCWGG	1 cut(s)	258
BciVI	GTATCC	1 cut(s)	7
BcnI	CCSGG	1 cut(s)	389
BcoDI	GTCTC	1 cut(s)	355
BfuI	GTATCC	1 cut(s)	7
BglII	AGATCT	1 cut(s)	195
Bme1390I	CCNGG	2 cut(s)	258, 389
Bme18I	GGWCC	1 cut(s)	189
BmgT120I	GGNCC	2 cut(s)	189, 241
BmiI	GGNNCC	1 cut(s)	139
BmrFI	CCNGG	2 cut(s)	258, 389
BmsI	GCATC	2 cut(s)	90, 281
BpuEI	CTTGAG	1 cut(s)	59
BpuMI	CCSGG	1 cut(s)	389
BsaXI	ACNNNNNCTCC	2 cut(s)	101, 131
Bsc4I	CCNNNNNNNGG	2 cut(s)	24, 147
BseBI	CCWGG	1 cut(s)	258
BseGI	GGATG	1 cut(s)	337
BseLI	CCNNNNNNNGG	2 cut(s)	24, 147
BseMII	CTCAG	1 cut(s)	416
BseYI	CCCAGC	1 cut(s)	398
Bsh1236I	CGCG	2 cut(s)	53, 113
BshFI	GGCC	1 cut(s)	243
BsiHKAI	GWGCWC	1 cut(s)	119
BsiSI	CCGG	1 cut(s)	388
BslI	CCNNNNNNNGG	2 cut(s)	24, 147
BsmAI	GTCTC	1 cut(s)	355
BsmBI	CGTCTC	1 cut(s)	355
BsnI	GGCC	1 cut(s)	243
Bsp1286I	GDGCHC	1 cut(s)	119
Bsp143I	GATC	3 cut(s)	159, 195, 213
BspACI	CCGC	3 cut(s)	123, 141, 187
BspANI	GGCC	1 cut(s)	243
BspCNI	CTCAG	1 cut(s)	417
BspFNI	CGCG	2 cut(s)	53, 113
BspLI	GGNNCC	1 cut(s)	139
BspPI	GGATC	2 cut(s)	154, 208
BssMI	GATC	3 cut(s)	159, 195, 213
Bst2UI	CCWGG	1 cut(s)	258
Bst4CI	ACNGT	2 cut(s)	131, 299
BstC8I	GCNNGC	2 cut(s)	115, 348
BstDEI	CTNAG	1 cut(s)	425
BstF5I	GGATG	1 cut(s)	337
BstFNI	CGCG	2 cut(s)	53, 113
BstHHI	GCGC	2 cut(s)	55, 81
BstKTI	GATC	3 cut(s)	162, 198, 216
BstMAI	GTCTC	1 cut(s)	355
BstMBI	GATC	3 cut(s)	159, 195, 213
BstNI	CCWGG	1 cut(s)	258
BstSCI	CCNGG	2 cut(s)	256, 387
BstUI	CGCG	2 cut(s)	53, 113
BstX2I	RGATCY	1 cut(s)	195
BstYI	RGATCY	1 cut(s)	195
BsuI	GTATCC	1 cut(s)	7
BsuRI	GGCC	1 cut(s)	243
BtgZI	GCGATG	1 cut(s)	67
BtsCI	GGATG	1 cut(s)	337
BtsIMutI	CAGTG	2 cut(s)	38, 422
Cac8I	GCNNGC	2 cut(s)	115, 348
CfoI	GCGC	2 cut(s)	55, 81
Cfr13I	GGNCC	2 cut(s)	189, 241
CviJI	RGCY	5 cut(s)	68, 101, 138, 243, 350
CviKI_1	RGCY	5 cut(s)	68, 101, 138, 243, 350
DdeI	CTNAG	1 cut(s)	425
DpnI	GATC	3 cut(s)	161, 197, 215
DpnII	GATC	3 cut(s)	159, 195, 213
EciI	GGCGGA	1 cut(s)	130
Eco47I	GGWCC	1 cut(s)	189
EcoO109I	RGGNCCY	1 cut(s)	241
EcoRI	GAATTC	2 cut(s)	374, 383
EcoRII	CCWGG	1 cut(s)	256
Esp3I	CGTCTC	1 cut(s)	355
FaiI	YATR	6 cut(s)	10, 135, 237, 276, 306, 404
FokI	GGATG	1 cut(s)	344
GlaI	GCGC	2 cut(s)	54, 80
GsaI	CCCAGC	1 cut(s)	402
HaeIII	GGCC	1 cut(s)	243
HapII	CCGG	1 cut(s)	388
HhaI	GCGC	2 cut(s)	55, 81
Hin6I	GCGC	2 cut(s)	53, 79
HinP1I	GCGC	2 cut(s)	53, 79
HinfI	GANTC	3 cut(s)	35, 311, 392
HpaII	CCGG	1 cut(s)	388
HphI	GGTGA	1 cut(s)	392
Hpy166II	GTNNAC	1 cut(s)	422
Hpy188I	TCNGA	1 cut(s)	290
Hpy188III	TCNNGA	2 cut(s)	106, 360
Hpy8I	GTNNAC	1 cut(s)	422
HpyCH4III	ACNGT	2 cut(s)	131, 299
HpyCH4IV	ACGT	1 cut(s)	411
HpyCH4V	TGCA	2 cut(s)	269, 346
HpyF3I	CTNAG	1 cut(s)	425
HpySE526I	ACGT	1 cut(s)	411
HspAI	GCGC	2 cut(s)	53, 79
Kzo9I	GATC	3 cut(s)	159, 195, 213
LmnI	GCTCC	2 cut(s)	122, 143
LpnPI	CCDG	6 cut(s)	133, 243, 270, 332, 401, 412
LweI	GCATC	2 cut(s)	90, 281
MaeII	ACGT	1 cut(s)	411
MaeIII	GTNAC	1 cut(s)	299
MalI	GATC	3 cut(s)	161, 197, 215
MboI	GATC	3 cut(s)	159, 195, 213
MboII	GAAGA	1 cut(s)	383
MflI	RGATCY	1 cut(s)	195
MhlI	GDGCHC	1 cut(s)	119
MluCI	AATT	6 cut(s)	204, 248, 264, 341, 374, 383
MluI	ACGCGT	1 cut(s)	111
MnlI	CCTC	4 cut(s)	172, 227, 232, 361
MseI	TTAA	1 cut(s)	222
MspA1I	CMGCKG	1 cut(s)	101
MspI	CCGG	1 cut(s)	388
MspR9I	CCNGG	2 cut(s)	258, 389
MvaI	CCWGG	1 cut(s)	258
MvnI	CGCG	2 cut(s)	53, 113
NciI	CCSGG	1 cut(s)	389
NdeII	GATC	3 cut(s)	159, 195, 213
NlaIV	GGNNCC	1 cut(s)	139
NmuCI	GTSAC	1 cut(s)	299
PfeI	GAWTC	3 cut(s)	35, 311, 392
PflMI	CCANNNNNTGG	1 cut(s)	24
PfoI	TCCNGGA	1 cut(s)	387
PsiI	TTATAA	1 cut(s)	276
Psp1406I	AACGTT	1 cut(s)	411
Psp6I	CCWGG	1 cut(s)	256
PspFI	CCCAGC	1 cut(s)	398
PspGI	CCWGG	1 cut(s)	256
PspN4I	GGNNCC	1 cut(s)	139
PspPI	GGNCC	2 cut(s)	189, 241
PsuI	RGATCY	1 cut(s)	195
PvuII	CAGCTG	1 cut(s)	101
SaqAI	TTAA	1 cut(s)	222
Sau3AI	GATC	3 cut(s)	159, 195, 213
Sau96I	GGNCC	2 cut(s)	189, 241
ScrFI	CCNGG	2 cut(s)	258, 389
SduI	GDGCHC	1 cut(s)	119
SetI	ASST	4 cut(s)	103, 236, 262, 414
SfaNI	GCATC	2 cut(s)	90, 281
SinI	GGWCC	1 cut(s)	189
SmlI	CTYRAG	1 cut(s)	74
SmoI	CTYRAG	1 cut(s)	74
Sse9I	AATT	6 cut(s)	204, 248, 264, 341, 374, 383
SsiI	CCGC	3 cut(s)	123, 141, 187
StyD4I	CCNGG	2 cut(s)	256, 387
TaaI	ACNGT	2 cut(s)	131, 299
TaiI	ACGT	1 cut(s)	414
TaqI	TCGA	1 cut(s)	359
TasI	AATT	6 cut(s)	204, 248, 264, 341, 374, 383
TfiI	GAWTC	3 cut(s)	35, 311, 392
Tru1I	TTAA	1 cut(s)	222
Tru9I	TTAA	1 cut(s)	222
TscAI	CASTG	2 cut(s)	45, 422
TseFI	GTSAC	1 cut(s)	299
Tsp45I	GTSAC	1 cut(s)	299
TspGWI	ACGGA	1 cut(s)	61
TspRI	CASTG	2 cut(s)	45, 422
Van91I	CCANNNNNTGG	1 cut(s)	24
VpaK11BI	GGWCC	1 cut(s)	189
XapI	RAATTY	3 cut(s)	248, 374, 383

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.