Rmu_co8077932.1_g000001

Methyl-CpG binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8077932.1
OG0002094
Physical Location & Seq
Forward (+)
1 .. 582
582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8077932.1_g000001.1.cds

Sequence Viewer

Length: 582 bp
aagcttgaaggaaaaatgacaatagttgaagttgatggttccttgagagatcctggcaaagtgattttttctgaaaacgaccctgctttgactcctgcttcaaacaccttgaataacaggaactcactcatgagtcagatggaaaacaggaacatcagaaggtcccaggtagacaatagaaaattgaaaaaggacaagtttaatttgcctcgtcggtcctcaaaacgacttgctgggcaacaaccagagccagtaaataacctggtttcaactgtacaggctcgtcaagttgcagctataaagtctagtaaaggggatggcagacaagatgcaggtttggcttcagatgatcttgaaaatagagcacctcagcagcttggggatgcattagaaacagaggttgcagaccatactctaactgaagtaaattctacactacaaggagagccattgagcaagttcaagaggctacttgaaggtcttgaactacagcggtctgttgattccttgggttccaacgaacaaactcttcaagttgcaaccagagagtctagtagaggtgatgccagtcgagatgcgggt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MBD

Protein Analysis

194

Amino Acids

21.26

Weight (kDa)

8.18

Isoelectric Point (pI)

55.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 323
AccI GTMKAC 1 cut(s) 171
AciI CCGC 2 cut(s) 493, 578
AclWI GGATC 1 cut(s) 44
AcsI RAATTY 1 cut(s) 427
AcuI CTGAAG 2 cut(s) 327, 441
AfaI GTAC 1 cut(s) 276
AjnI CCWGG 3 cut(s) 52, 165, 261
AluBI AGCT 3 cut(s) 4, 296, 376
AluI AGCT 3 cut(s) 4, 296, 376
Alw21I GWGCWC 1 cut(s) 367
AlwI GGATC 1 cut(s) 44
ApeKI GCWGC 2 cut(s) 293, 373
ApoI RAATTY 1 cut(s) 427
AspS9I GGNCC 2 cut(s) 162, 216
AsuHPI GGTGA 1 cut(s) 572
AvaII GGWCC 2 cut(s) 162, 216
Bbv12I GWGCWC 1 cut(s) 367
BbvCI CCTCAGC 1 cut(s) 369
BbvI GCAGC 2 cut(s) 305, 385
BccI CCATC 3 cut(s) 29, 133, 311
BciT130I CCWGG 3 cut(s) 54, 167, 263
BfaI CTAG 2 cut(s) 306, 552
BfmI CTRYAG 1 cut(s) 488
BfuAI ACCTGC 1 cut(s) 323
BisI GCNGC 2 cut(s) 294, 374
BlsI GCNGC 2 cut(s) 295, 375
Bme1390I CCNGG 3 cut(s) 54, 167, 263
Bme18I GGWCC 2 cut(s) 162, 216
BmgT120I GGNCC 2 cut(s) 162, 216
BmiI GGNNCC 3 cut(s) 40, 164, 514
BmrFI CCNGG 3 cut(s) 54, 167, 263
BmsI GCATC 4 cut(s) 319, 373, 553, 565
Bpu10I CCTNAGC 1 cut(s) 369
BpuEI CTTGAG 1 cut(s) 64
BsaJI CCNNGG 2 cut(s) 165, 507
Bse1I ACTGG 2 cut(s) 251, 567
BseBI CCWGG 3 cut(s) 54, 167, 263
BseDI CCNNGG 2 cut(s) 165, 507
BseGI GGATG 2 cut(s) 322, 388
BseMII CTCAG 1 cut(s) 383
BseNI ACTGG 2 cut(s) 251, 567
BseXI GCAGC 2 cut(s) 305, 385
BseYI CCCAGC 1 cut(s) 233
BsiHKAI GWGCWC 1 cut(s) 367
BslFI GGGAC 1 cut(s) 148
BsmFI GGGAC 1 cut(s) 148
Bsp1286I GDGCHC 1 cut(s) 367
Bsp1407I TGTACA 1 cut(s) 274
Bsp143I GATC 2 cut(s) 49, 349
BspACI CCGC 2 cut(s) 493, 578
BspCNI CTCAG 1 cut(s) 382
BspHI TCATGA 1 cut(s) 129
BspLI GGNNCC 3 cut(s) 40, 164, 514
BspMI ACCTGC 1 cut(s) 323
BspPI GGATC 1 cut(s) 44
BsrGI TGTACA 1 cut(s) 274
BsrI ACTGG 2 cut(s) 251, 567
BssECI CCNNGG 2 cut(s) 165, 507
BssMI GATC 2 cut(s) 49, 349
BssT1I CCWWGG 1 cut(s) 507
Bst2UI CCWGG 3 cut(s) 54, 167, 263
Bst4CI ACNGT 1 cut(s) 274
Bst6I CTCTTC 1 cut(s) 534
BstAUI TGTACA 1 cut(s) 274
BstDEI CTNAG 1 cut(s) 369
BstF5I GGATG 2 cut(s) 322, 388
BstKTI GATC 2 cut(s) 52, 352
BstMBI GATC 2 cut(s) 49, 349
BstMWI GCNNNNNNNGC 1 cut(s) 338
BstNI CCWGG 3 cut(s) 54, 167, 263
BstSCI CCNGG 3 cut(s) 52, 165, 261
BstSFI CTRYAG 1 cut(s) 488
BstV1I GCAGC 2 cut(s) 305, 385
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BtsCI GGATG 2 cut(s) 322, 388
BveI ACCTGC 1 cut(s) 323
CciI TCATGA 1 cut(s) 129
Cfr13I GGNCC 2 cut(s) 162, 216
CsiI ACCWGGT 1 cut(s) 261
Csp6I GTAC 1 cut(s) 275
CviAII CATG 1 cut(s) 130
CviJI RGCY 8 cut(s) 4, 250, 281, 296, 341, 376, 448, 469
CviKI_1 RGCY 8 cut(s) 4, 250, 281, 296, 341, 376, 448, 469
CviQI GTAC 1 cut(s) 275
DdeI CTNAG 1 cut(s) 369
DpnI GATC 2 cut(s) 51, 351
DpnII GATC 2 cut(s) 49, 349
Eam1104I CTCTTC 1 cut(s) 534
EarI CTCTTC 1 cut(s) 534
Eco130I CCWWGG 1 cut(s) 507
Eco47I GGWCC 2 cut(s) 162, 216
Eco57I CTGAAG 2 cut(s) 327, 441
EcoO109I RGGNCCY 1 cut(s) 162
EcoRII CCWGG 3 cut(s) 52, 165, 261
EcoT14I CCWWGG 1 cut(s) 507
EcoT22I ATGCAT 1 cut(s) 388
ErhI CCWWGG 1 cut(s) 507
FaeI CATG 1 cut(s) 133
FaiI YATR 3 cut(s) 131, 299, 411
FaqI GGGAC 1 cut(s) 148
FatI CATG 1 cut(s) 129
FauI CCCGC 1 cut(s) 571
FblI GTMKAC 1 cut(s) 171
Fnu4HI GCNGC 2 cut(s) 294, 374
FokI GGATG 2 cut(s) 329, 395
Fsp4HI GCNGC 2 cut(s) 294, 374
FspBI CTAG 2 cut(s) 306, 552
GluI GCNGC 2 cut(s) 294, 374
GsaI CCCAGC 1 cut(s) 237
Hin1II CATG 1 cut(s) 133
HindIII AAGCTT 1 cut(s) 2
HinfI GANTC 4 cut(s) 91, 133, 503, 548
HphI GGTGA 1 cut(s) 572
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 4 cut(s) 73, 138, 158, 346
Hpy188III TCNNGA 5 cut(s) 130, 353, 463, 482, 572
Hpy8I GTNNAC 1 cut(s) 172
Hpy99I CGWCG 1 cut(s) 216
HpyAV CCTTC 2 cut(s) 153, 470
HpyCH4III ACNGT 1 cut(s) 274
HpyCH4V TGCA 5 cut(s) 293, 332, 386, 404, 539
HpyF10VI GCNNNNNNNGC 1 cut(s) 338
HpyF3I CTNAG 1 cut(s) 369
Hsp92II CATG 1 cut(s) 133
Kzo9I GATC 2 cut(s) 49, 349
Lsp1109I GCAGC 2 cut(s) 305, 385
LweI GCATC 4 cut(s) 319, 373, 553, 565
MabI ACCWGGT 1 cut(s) 261
MaeI CTAG 2 cut(s) 306, 552
MalI GATC 2 cut(s) 51, 351
MboI GATC 2 cut(s) 49, 349
MboII GAAGA 1 cut(s) 521
MflI RGATCY 1 cut(s) 49
MhlI GDGCHC 1 cut(s) 367
MluCI AATT 3 cut(s) 182, 202, 427
MlyI GAGTC 3 cut(s) 85, 142, 557
MmeI TCCRAC 1 cut(s) 540
MnlI CCTC 6 cut(s) 219, 229, 378, 391, 459, 551
Mph1103I ATGCAT 1 cut(s) 388
MseI TTAA 1 cut(s) 201
MspA1I CMGCKG 1 cut(s) 493
MspR9I CCNGG 3 cut(s) 54, 167, 263
MvaI CCWGG 3 cut(s) 54, 167, 263
MwoI GCNNNNNNNGC 1 cut(s) 338
NdeII GATC 2 cut(s) 49, 349
NlaIII CATG 1 cut(s) 133
NlaIV GGNNCC 3 cut(s) 40, 164, 514
NsiI ATGCAT 1 cut(s) 388
PagI TCATGA 1 cut(s) 129
PfeI GAWTC 1 cut(s) 503
PkrI GCNGC 2 cut(s) 295, 375
PleI GAGTC 3 cut(s) 85, 141, 556
PpsI GAGTC 3 cut(s) 85, 141, 556
PpuMI RGGWCCY 1 cut(s) 162
Psp5II RGGWCCY 1 cut(s) 162
Psp6I CCWGG 3 cut(s) 52, 165, 261
PspFI CCCAGC 1 cut(s) 233
PspGI CCWGG 3 cut(s) 52, 165, 261
PspN4I GGNNCC 3 cut(s) 40, 164, 514
PspPI GGNCC 2 cut(s) 162, 216
PspPPI RGGWCCY 1 cut(s) 162
PsuI RGATCY 1 cut(s) 49
RsaI GTAC 1 cut(s) 276
RsaNI GTAC 1 cut(s) 275
SaqAI TTAA 1 cut(s) 201
SatI GCNGC 2 cut(s) 294, 374
Sau3AI GATC 2 cut(s) 49, 349
Sau96I GGNCC 2 cut(s) 162, 216
SchI GAGTC 3 cut(s) 85, 142, 557
ScrFI CCNGG 3 cut(s) 54, 167, 263
SduI GDGCHC 1 cut(s) 367
SexAI ACCWGGT 1 cut(s) 261
SfaNI GCATC 4 cut(s) 319, 373, 553, 565
SfcI CTRYAG 1 cut(s) 488
SinI GGWCC 2 cut(s) 162, 216
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 3 cut(s) 182, 202, 427
SsiI CCGC 2 cut(s) 493, 578
SspMI CTAG 2 cut(s) 306, 552
StyD4I CCNGG 3 cut(s) 52, 165, 261
StyI CCWWGG 1 cut(s) 507
TaaI ACNGT 1 cut(s) 274
TaqI TCGA 1 cut(s) 571
TaqII GACCGA 1 cut(s) 204
TasI AATT 3 cut(s) 182, 202, 427
TatI WGTACW 1 cut(s) 274
TfiI GAWTC 1 cut(s) 503
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TseI GCWGC 2 cut(s) 293, 373
VpaK11BI GGWCC 2 cut(s) 162, 216
XapI RAATTY 1 cut(s) 427
XmiI GTMKAC 1 cut(s) 171
XspI CTAG 2 cut(s) 306, 552
Zsp2I ATGCAT 1 cut(s) 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.