Rmu_co8206768.1_g000001

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8206768.1
Physical Location & Seq
Reverse (-)
242 .. 709
468 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8206768.1_g000001.1.cds

Sequence Viewer

Length: 261 bp
atgataagggaggtggcatttagaacaaaggtattccacccaaacattaacagcaatgggagcatttgcctcgacatcttgaaggagcaatggagtcctgctctaaccatttccaaggtgttgctttcaatctgttcactgttgacggatccaaatcccgatgatccattggtgccagagattgctcacatgtacaagacagacaggaacaagtatgagacaacagcaagaagctggacccaaaaatatgccatgggctaa

Protein Analysis

86

Amino Acids

9.82

Weight (kDa)

7.79

Isoelectric Point (pI)

38.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 172
AclWI GGATC 3 cut(s) 143, 156, 158
AfaI GTAC 1 cut(s) 194
AflIII ACRYGT 1 cut(s) 189
AgsI TTSAA 2 cut(s) 82, 129
AluBI AGCT 1 cut(s) 234
AluI AGCT 1 cut(s) 234
Alw26I GTCTC 1 cut(s) 212
AlwI GGATC 3 cut(s) 143, 156, 158
AspS9I GGNCC 1 cut(s) 237
AvaII GGWCC 1 cut(s) 237
BamHI GGATCC 1 cut(s) 148
BanI GGYRCC 1 cut(s) 172
BcgI CGANNNNNNTGC 2 cut(s) 52, 86
BcoDI GTCTC 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 237
BmgT120I GGNCC 1 cut(s) 237
BmiI GGNNCC 3 cut(s) 150, 174, 239
BplI GAGNNNNNCTC 2 cut(s) 85, 117
BsaBI GATNNNNATC 1 cut(s) 153
BsaJI CCNNGG 2 cut(s) 114, 252
Bse3DI GCAATG 2 cut(s) 61, 95
Bse8I GATNNNNATC 1 cut(s) 153
BseDI CCNNGG 2 cut(s) 114, 252
BseJI GATNNNNATC 1 cut(s) 153
BseMI GCAATG 2 cut(s) 61, 95
BshNI GGYRCC 1 cut(s) 172
BsmAI GTCTC 1 cut(s) 212
Bsp1407I TGTACA 1 cut(s) 192
Bsp143I GATC 2 cut(s) 148, 163
Bsp19I CCATGG 1 cut(s) 252
BspLI GGNNCC 3 cut(s) 150, 174, 239
BspPI GGATC 3 cut(s) 143, 156, 158
BspT107I GGYRCC 1 cut(s) 172
BsrDI GCAATG 2 cut(s) 61, 95
BsrGI TGTACA 1 cut(s) 192
BssECI CCNNGG 2 cut(s) 114, 252
BssMI GATC 2 cut(s) 148, 163
BssT1I CCWWGG 2 cut(s) 114, 252
Bst4CI ACNGT 1 cut(s) 141
BstAUI TGTACA 1 cut(s) 192
BstDSI CCRYGG 1 cut(s) 252
BstKTI GATC 2 cut(s) 151, 166
BstMAI GTCTC 1 cut(s) 212
BstMBI GATC 2 cut(s) 148, 163
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 193
BstX2I RGATCY 1 cut(s) 148
BstYI RGATCY 1 cut(s) 148
BtgI CCRYGG 1 cut(s) 252
BtsIMutI CAGTG 1 cut(s) 137
Cfr13I GGNCC 1 cut(s) 237
Csp6I GTAC 1 cut(s) 193
CviAII CATG 2 cut(s) 190, 253
CviJI RGCY 2 cut(s) 234, 258
CviKI_1 RGCY 2 cut(s) 234, 258
CviQI GTAC 1 cut(s) 193
DpnI GATC 2 cut(s) 150, 165
DpnII GATC 2 cut(s) 148, 163
Eco130I CCWWGG 2 cut(s) 114, 252
Eco47I GGWCC 1 cut(s) 237
EcoT14I CCWWGG 2 cut(s) 114, 252
ErhI CCWWGG 2 cut(s) 114, 252
FaeI CATG 2 cut(s) 193, 256
FaiI YATR 4 cut(s) 191, 216, 249, 254
FatI CATG 2 cut(s) 189, 252
Hin1II CATG 2 cut(s) 193, 256
HincII GTYRAC 1 cut(s) 144
HindII GTYRAC 1 cut(s) 144
HinfI GANTC 1 cut(s) 94
Hpy166II GTNNAC 2 cut(s) 137, 144
Hpy188III TCNNGA 2 cut(s) 79, 158
Hpy8I GTNNAC 2 cut(s) 137, 144
HpyAV CCTTC 1 cut(s) 76
HpyCH4III ACNGT 1 cut(s) 141
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
Hsp92II CATG 2 cut(s) 193, 256
Kzo9I GATC 2 cut(s) 148, 163
LmnI GCTCC 2 cut(s) 60, 85
LpnPI CCDG 4 cut(s) 111, 189, 190, 220
MalI GATC 2 cut(s) 150, 165
MboI GATC 2 cut(s) 148, 163
MflI RGATCY 1 cut(s) 148
MlyI GAGTC 1 cut(s) 103
MnlI CCTC 2 cut(s) 4, 80
MseI TTAA 1 cut(s) 48
MwoI GCNNNNNNNGC 1 cut(s) 60
NcoI CCATGG 1 cut(s) 252
NdeII GATC 2 cut(s) 148, 163
NlaIII CATG 2 cut(s) 193, 256
NlaIV GGNNCC 3 cut(s) 150, 174, 239
NspI RCATGY 1 cut(s) 193
PciI ACATGT 1 cut(s) 189
PleI GAGTC 1 cut(s) 102
PpsI GAGTC 1 cut(s) 102
PscI ACATGT 1 cut(s) 189
PspN4I GGNNCC 3 cut(s) 150, 174, 239
PspPI GGNCC 1 cut(s) 237
PsuI RGATCY 1 cut(s) 148
RsaI GTAC 1 cut(s) 194
RsaNI GTAC 1 cut(s) 193
SaqAI TTAA 1 cut(s) 48
Sau3AI GATC 2 cut(s) 148, 163
Sau96I GGNCC 1 cut(s) 237
SchI GAGTC 1 cut(s) 103
SetI ASST 4 cut(s) 15, 33, 120, 236
SinI GGWCC 1 cut(s) 237
StyI CCWWGG 2 cut(s) 114, 252
TaaI ACNGT 1 cut(s) 141
TaqI TCGA 1 cut(s) 72
TatI WGTACW 1 cut(s) 192
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TscAI CASTG 1 cut(s) 144
TspGWI ACGGA 1 cut(s) 161
TspRI CASTG 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 237
XceI RCATGY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.