Rmu_co8384813.1_g000001

carboxylesterase 11

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8384813.1
OG0003700
Physical Location & Seq
Reverse (-)
99 .. 1150
1052 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8384813.1_g000001.1.cds

Sequence Viewer

Length: 606 bp
atggcccccgaccaagacgacgctgaaggcgacctctcctcctccccccaagacaacgtcgttgaagaggacgtcgacgactccgcctctcctttctccacctccgatggcgtcacctcccggctcgaagaaagcatcgcagccgccaatcccttgttcgactacggcgtcgctaccaaggacatccacatcgatccttttacttctttatctattcgaatcttcctccccgaatctgctctcaacctgccggaccctccgagtccgaaagagccgttccatccttccagccgcaacagctgcggcaacgcggtagtgacgaaatacgttgtatgtgcttcagttcttagctctaaagctctgatgctatcttggctcggcgtgtggcggagtgtcagcggtgatatagctaattatgcttgcaaatgctcacgtaagtacacgttgagagctgagccgaggaggaacaactgcggcttcagcaacgttgttgaggggttgaatttgatggccggagccggctctggggtctacagagggtactcgccgggtccgacgaagcaagagattacagccactgattcgattaagttcgaatcaagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0009056 GO:0016787
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

201

Amino Acids

21.57

Weight (kDa)

4.76

Isoelectric Point (pI)

62.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 167
AatII GACGTC 1 cut(s) 75
Acc36I ACCTGC 1 cut(s) 255
AccI GTMKAC 2 cut(s) 75, 531
AccII CGCG 1 cut(s) 311
AciI CCGC 8 cut(s) 84, 144, 292, 303, 311, 388, 399, 474
AclI AACGTT 1 cut(s) 486
AclWI GGATC 1 cut(s) 188
AcoI YGGCCR 1 cut(s) 510
AcsI RAATTY 1 cut(s) 502
AcuI CTGAAG 3 cut(s) 45, 324, 463
AcyI GRCGYC 3 cut(s) 72, 111, 168
AfaI GTAC 2 cut(s) 440, 542
AfiI CCNNNNNNNGG 1 cut(s) 525
AflIII ACRYGT 1 cut(s) 441
AgsI TTSAA 2 cut(s) 65, 502
AjuI GAANNNNNNNTTGG 2 cut(s) 140, 172
AluBI AGCT 5 cut(s) 300, 351, 359, 410, 452
AluI AGCT 5 cut(s) 300, 351, 359, 410, 452
AlwI GGATC 1 cut(s) 188
AlwNI CAGNNNCTG 1 cut(s) 578
AoxI GGCC 2 cut(s) 3, 510
ApeKI GCWGC 2 cut(s) 140, 300
ApoI RAATTY 1 cut(s) 502
AspS9I GGNCC 3 cut(s) 4, 253, 551
AsuC2I CCSGG 2 cut(s) 121, 549
AsuHPI GGTGA 2 cut(s) 106, 413
AsuII TTCGAA 2 cut(s) 217, 594
AvaII GGWCC 2 cut(s) 253, 551
BbvI GCAGC 2 cut(s) 152, 287
BccI CCATC 3 cut(s) 101, 288, 502
BceAI ACGGC 2 cut(s) 181, 259
BcnI CCSGG 2 cut(s) 121, 549
BfmI CTRYAG 1 cut(s) 532
BfuAI ACCTGC 1 cut(s) 255
BisI GCNGC 6 cut(s) 141, 144, 292, 301, 304, 475
BlpI GCTNAGC 1 cut(s) 453
BlsI GCNGC 6 cut(s) 142, 145, 293, 302, 305, 476
Bme1390I CCNGG 2 cut(s) 121, 549
Bme18I GGWCC 2 cut(s) 253, 551
BmgT120I GGNCC 3 cut(s) 4, 253, 551
BmiI GGNNCC 4 cut(s) 6, 255, 517, 552
BmrFI CCNGG 2 cut(s) 121, 549
BmsI GCATC 2 cut(s) 144, 354
Bpu1102I GCTNAGC 1 cut(s) 453
Bpu14I TTCGAA 2 cut(s) 217, 594
BpuMI CCSGG 2 cut(s) 121, 549
Bsa29I ATCGAT 1 cut(s) 192
BsaAI YACGTR 1 cut(s) 434
BsaHI GRCGYC 3 cut(s) 72, 111, 168
BsaJI CCNNGG 2 cut(s) 177, 458
BsaXI ACNNNNNCTCC 2 cut(s) 23, 53
Bsc4I CCNNNNNNNGG 1 cut(s) 525
Bse118I RCCGGY 1 cut(s) 518
BseCI ATCGAT 1 cut(s) 192
BseDI CCNNGG 2 cut(s) 177, 458
BseGI GGATG 2 cut(s) 183, 280
BseLI CCNNNNNNNGG 1 cut(s) 525
BseMII CTCAG 1 cut(s) 444
BseRI GAGGAG 3 cut(s) 28, 31, 475
BseXI GCAGC 2 cut(s) 152, 287
Bsh1236I CGCG 1 cut(s) 311
BshFI GGCC 2 cut(s) 5, 512
BshVI ATCGAT 1 cut(s) 192
BsiSI CCGG 5 cut(s) 121, 251, 513, 519, 548
BslI CCNNNNNNNGG 1 cut(s) 525
BsnI GGCC 2 cut(s) 5, 512
Bsp119I TTCGAA 2 cut(s) 217, 594
Bsp143I GATC 1 cut(s) 193
Bsp1720I GCTNAGC 1 cut(s) 453
BspACI CCGC 8 cut(s) 84, 144, 292, 303, 311, 388, 399, 474
BspANI GGCC 2 cut(s) 5, 512
BspCNI CTCAG 1 cut(s) 445
BspDI ATCGAT 1 cut(s) 192
BspFNI CGCG 1 cut(s) 311
BspLI GGNNCC 4 cut(s) 6, 255, 517, 552
BspMI ACCTGC 1 cut(s) 255
BspPI GGATC 1 cut(s) 188
BspT104I TTCGAA 2 cut(s) 217, 594
BsrFI RCCGGY 1 cut(s) 518
BssAI RCCGGY 1 cut(s) 518
BssECI CCNNGG 2 cut(s) 177, 458
BssMI GATC 1 cut(s) 193
BssNI GRCGYC 3 cut(s) 72, 111, 168
BssT1I CCWWGG 1 cut(s) 177
Bst6I CTCTTC 1 cut(s) 60
BstACI GRCGYC 3 cut(s) 72, 111, 168
BstAPI GCANNNNNTGC 1 cut(s) 300
BstBAI YACGTR 1 cut(s) 434
BstBI TTCGAA 2 cut(s) 217, 594
BstC8I GCNNGC 2 cut(s) 421, 520
BstDEI CTNAG 2 cut(s) 347, 453
BstF5I GGATG 2 cut(s) 183, 280
BstFNI CGCG 1 cut(s) 311
BstKTI GATC 1 cut(s) 196
BstMBI GATC 1 cut(s) 193
BstMWI GCNNNNNNNGC 5 cut(s) 297, 300, 373, 416, 480
BstSCI CCNGG 2 cut(s) 119, 547
BstSFI CTRYAG 1 cut(s) 532
BstUI CGCG 1 cut(s) 311
BstV1I GCAGC 2 cut(s) 152, 287
Bsu15I ATCGAT 1 cut(s) 192
BsuRI GGCC 2 cut(s) 5, 512
BsuTUI ATCGAT 1 cut(s) 192
BtgZI GCGATG 1 cut(s) 121
BtsCI GGATG 2 cut(s) 183, 280
BtsIMutI CAGTG 1 cut(s) 576
BveI ACCTGC 1 cut(s) 255
Cac8I GCNNGC 2 cut(s) 421, 520
CaiI CAGNNNCTG 1 cut(s) 578
Cfr10I RCCGGY 1 cut(s) 518
Cfr13I GGNCC 3 cut(s) 4, 253, 551
ClaI ATCGAT 1 cut(s) 192
CseI GACGC 3 cut(s) 29, 100, 157
Csp6I GTAC 2 cut(s) 439, 541
CviQI GTAC 2 cut(s) 439, 541
DdeI CTNAG 2 cut(s) 347, 453
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
DrdI GACNNNNNNGTC 1 cut(s) 167
DseDI GACNNNNNNGTC 1 cut(s) 167
EaeI YGGCCR 1 cut(s) 510
Eam1104I CTCTTC 1 cut(s) 60
EarI CTCTTC 1 cut(s) 60
EciI GGCGGA 2 cut(s) 73, 403
Eco130I CCWWGG 1 cut(s) 177
Eco47I GGWCC 2 cut(s) 253, 551
Eco57I CTGAAG 3 cut(s) 45, 324, 463
EcoT14I CCWWGG 1 cut(s) 177
ErhI CCWWGG 1 cut(s) 177
FaiI YATR 3 cut(s) 334, 407, 417
FblI GTMKAC 2 cut(s) 75, 531
Fnu4HI GCNGC 6 cut(s) 141, 144, 292, 301, 304, 475
FokI GGATG 2 cut(s) 170, 267
Fsp4HI GCNGC 6 cut(s) 141, 144, 292, 301, 304, 475
GluI GCNGC 6 cut(s) 141, 144, 292, 301, 304, 475
HaeIII GGCC 2 cut(s) 5, 512
HapII CCGG 5 cut(s) 121, 251, 513, 519, 548
HgaI GACGC 3 cut(s) 29, 100, 157
Hin1I GRCGYC 3 cut(s) 72, 111, 168
HincII GTYRAC 1 cut(s) 76
HindII GTYRAC 1 cut(s) 76
HinfI GANTC 6 cut(s) 80, 219, 233, 262, 581, 596
HpaII CCGG 5 cut(s) 121, 251, 513, 519, 548
HphI GGTGA 2 cut(s) 106, 413
Hpy166II GTNNAC 3 cut(s) 76, 441, 532
Hpy188I TCNGA 5 cut(s) 106, 261, 267, 363, 555
Hpy188III TCNNGA 1 cut(s) 600
Hpy8I GTNNAC 3 cut(s) 76, 441, 532
Hpy99I CGWCG 6 cut(s) 23, 62, 77, 80, 173, 559
HpyAV CCTTC 2 cut(s) 20, 294
HpyCH4IV ACGT 6 cut(s) 57, 72, 327, 433, 443, 486
HpyCH4V TGCA 1 cut(s) 423
HpyF10VI GCNNNNNNNGC 5 cut(s) 297, 300, 373, 416, 480
HpyF3I CTNAG 2 cut(s) 347, 453
HpySE526I ACGT 6 cut(s) 57, 72, 327, 433, 443, 486
Hsp92I GRCGYC 3 cut(s) 72, 111, 168
KroI GCCGGC 1 cut(s) 518
KroNI GCCGGC 1 cut(s) 520
Kzo9I GATC 1 cut(s) 193
LmnI GCTCC 1 cut(s) 515
LpnPI CCDG 8 cut(s) 134, 260, 264, 301, 510, 526, 532, 561
Lsp1109I GCAGC 2 cut(s) 152, 287
LweI GCATC 2 cut(s) 144, 354
MaeII ACGT 6 cut(s) 57, 72, 327, 433, 443, 486
MaeIII GTNAC 2 cut(s) 112, 316
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MboII GAAGA 3 cut(s) 77, 140, 214
MluCI AATT 2 cut(s) 412, 502
MlyI GAGTC 2 cut(s) 74, 271
MmeI TCCRAC 1 cut(s) 578
MroNI GCCGGC 1 cut(s) 518
MseI TTAA 1 cut(s) 588
MspA1I CMGCKG 2 cut(s) 300, 399
MspI CCGG 5 cut(s) 121, 251, 513, 519, 548
MspR9I CCNGG 2 cut(s) 121, 549
MvnI CGCG 1 cut(s) 311
MwoI GCNNNNNNNGC 5 cut(s) 297, 300, 373, 416, 480
NaeI GCCGGC 1 cut(s) 520
NciI CCSGG 2 cut(s) 121, 549
NdeII GATC 1 cut(s) 193
NgoMIV GCCGGC 1 cut(s) 518
NlaIV GGNNCC 4 cut(s) 6, 255, 517, 552
NmeAIII GCCGAG 2 cut(s) 357, 483
NmuCI GTSAC 2 cut(s) 112, 316
NspV TTCGAA 2 cut(s) 217, 594
PcsI WCGNNNNNNNCGW 3 cut(s) 27, 165, 551
PdiI GCCGGC 1 cut(s) 520
PfeI GAWTC 4 cut(s) 219, 233, 581, 596
PflFI GACNNNGTC 1 cut(s) 56
PkrI GCNGC 6 cut(s) 142, 145, 293, 302, 305, 476
PleI GAGTC 2 cut(s) 74, 270
PpsI GAGTC 2 cut(s) 74, 270
Ppu21I YACGTR 1 cut(s) 434
Psp1406I AACGTT 1 cut(s) 486
PspN4I GGNNCC 4 cut(s) 6, 255, 517, 552
PspPI GGNCC 3 cut(s) 4, 253, 551
PstNI CAGNNNCTG 1 cut(s) 578
PsyI GACNNNGTC 1 cut(s) 56
PvuII CAGCTG 1 cut(s) 300
RsaI GTAC 2 cut(s) 440, 542
RsaNI GTAC 2 cut(s) 439, 541
SalI GTCGAC 1 cut(s) 74
SaqAI TTAA 1 cut(s) 588
SatI GCNGC 6 cut(s) 141, 144, 292, 301, 304, 475
Sau3AI GATC 1 cut(s) 193
Sau96I GGNCC 3 cut(s) 4, 253, 551
SchI GAGTC 2 cut(s) 74, 271
ScrFI CCNGG 2 cut(s) 121, 549
SfaNI GCATC 2 cut(s) 144, 354
SfcI CTRYAG 1 cut(s) 532
SfuI TTCGAA 2 cut(s) 217, 594
SgrDI CGTCGACG 1 cut(s) 74
SinI GGWCC 2 cut(s) 253, 551
Sse9I AATT 2 cut(s) 412, 502
SsiI CCGC 8 cut(s) 84, 144, 292, 303, 311, 388, 399, 474
StyD4I CCNGG 2 cut(s) 119, 547
StyI CCWWGG 1 cut(s) 177
TaiI ACGT 6 cut(s) 60, 75, 330, 436, 446, 489
TaqI TCGA 7 cut(s) 75, 126, 159, 192, 217, 584, 594
TasI AATT 2 cut(s) 412, 502
TatI WGTACW 1 cut(s) 438
TauI GCSGC 4 cut(s) 146, 294, 306, 477
TfiI GAWTC 4 cut(s) 219, 233, 581, 596
Tru1I TTAA 1 cut(s) 588
Tru9I TTAA 1 cut(s) 588
TscAI CASTG 1 cut(s) 583
TseFI GTSAC 2 cut(s) 112, 316
TseI GCWGC 2 cut(s) 140, 300
Tsp45I GTSAC 2 cut(s) 112, 316
TspRI CASTG 1 cut(s) 583
Tth111I GACNNNGTC 1 cut(s) 56
VpaK11BI GGWCC 2 cut(s) 253, 551
XapI RAATTY 1 cut(s) 502
XmiI GTMKAC 2 cut(s) 75, 531
ZraI GACGTC 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.