Rh1AG231700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
44040759 .. 44059945
19187 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG231700.1

Sequence Viewer

Length: 282 bp
ATGAGAATTAAGACGGCAACGTTGGGCATCGACAGCACAGTTAATTTGGAGTTTTCCCCGTTGGATGGGAAGATTGATTTGCCAATCTCTCGCTCTATAGTGAGAGGCTGGGTTGTTGTTGGTGGAGCATTGGAGGGGATTTGGGATTCTACCGTGAAGATTGGTATAGTGATTAGAGTTGGTTCAGAAGTGTATGATGGTGCAAGTAGGGCCACCACCAATTCGGGGGTGGTGGCCCTTGATGGTCGAACGACGGCTCTTCGGCTGATGGCGTCAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

9.73

Weight (kDa)

8.19

Isoelectric Point (pI)

23.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 20
AcyI GRCGYC 1 cut(s) 272
AfiI CCNNNNNNNGG 2 cut(s) 65, 225
AoxI GGCC 2 cut(s) 210, 234
AspS9I GGNCC 2 cut(s) 210, 235
BccI CCATC 4 cut(s) 59, 191, 236, 262
BceAI ACGGC 2 cut(s) 30, 270
BfaI CTAG 1 cut(s) 280
BfmI CTRYAG 1 cut(s) 96
BmgT120I GGNCC 2 cut(s) 210, 235
BmsI GCATC 1 cut(s) 36
BsaHI GRCGYC 1 cut(s) 272
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 225
BseGI GGATG 1 cut(s) 70
BseLI CCNNNNNNNGG 2 cut(s) 65, 225
BseYI CCCAGC 1 cut(s) 108
BshFI GGCC 2 cut(s) 212, 236
BslI CCNNNNNNNGG 2 cut(s) 65, 225
BsnI GGCC 2 cut(s) 212, 236
BspANI GGCC 2 cut(s) 212, 236
BspQI GCTCTTC 1 cut(s) 264
BssNI GRCGYC 1 cut(s) 272
Bst4CI ACNGT 2 cut(s) 40, 154
Bst6I CTCTTC 1 cut(s) 264
BstACI GRCGYC 1 cut(s) 272
BstF5I GGATG 1 cut(s) 70
BstMWI GCNNNNNNNGC 2 cut(s) 33, 209
BstSFI CTRYAG 1 cut(s) 96
BsuRI GGCC 2 cut(s) 212, 236
BtsCI GGATG 1 cut(s) 70
Cfr13I GGNCC 2 cut(s) 210, 235
CseI GACGC 1 cut(s) 261
CviJI RGCY 6 cut(s) 108, 212, 236, 257, 265, 279
CviKI_1 RGCY 6 cut(s) 108, 212, 236, 257, 265, 279
Eam1104I CTCTTC 1 cut(s) 264
EarI CTCTTC 1 cut(s) 264
FaiI YATR 3 cut(s) 98, 167, 195
FokI GGATG 1 cut(s) 77
FspBI CTAG 1 cut(s) 280
GsaI CCCAGC 1 cut(s) 112
HaeIII GGCC 2 cut(s) 212, 236
HgaI GACGC 1 cut(s) 261
Hin1I GRCGYC 1 cut(s) 272
HinfI GANTC 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 187
Hpy99I CGWCG 1 cut(s) 256
HpyCH4III ACNGT 2 cut(s) 40, 154
HpyCH4IV ACGT 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 203
HpyF10VI GCNNNNNNNGC 2 cut(s) 33, 209
HpySE526I ACGT 1 cut(s) 20
Hsp92I GRCGYC 1 cut(s) 272
LguI GCTCTTC 1 cut(s) 264
LmnI GCTCC 1 cut(s) 125
LpnPI CCDG 2 cut(s) 94, 261
LweI GCATC 1 cut(s) 36
MaeI CTAG 1 cut(s) 280
MaeII ACGT 1 cut(s) 20
MboII GAAGA 3 cut(s) 82, 169, 251
MluCI AATT 3 cut(s) 6, 43, 220
MmeI TCCRAC 1 cut(s) 42
MnlI CCTC 2 cut(s) 98, 127
MseI TTAA 2 cut(s) 9, 42
MwoI GCNNNNNNNGC 2 cut(s) 33, 209
PciSI GCTCTTC 1 cut(s) 264
PfeI GAWTC 1 cut(s) 146
Psp1406I AACGTT 1 cut(s) 20
PspFI CCCAGC 1 cut(s) 108
PspPI GGNCC 2 cut(s) 210, 235
SapI GCTCTTC 1 cut(s) 264
SaqAI TTAA 2 cut(s) 9, 42
Sau96I GGNCC 2 cut(s) 210, 235
SetI ASST 1 cut(s) 23
SfaNI GCATC 1 cut(s) 36
SfcI CTRYAG 1 cut(s) 96
SgeI CNNG 7 cut(s) 70, 102, 121, 166, 216, 237, 251
Sse9I AATT 3 cut(s) 6, 43, 220
SspMI CTAG 1 cut(s) 280
TaaI ACNGT 2 cut(s) 40, 154
TaiI ACGT 1 cut(s) 23
TaqI TCGA 2 cut(s) 30, 247
TasI AATT 3 cut(s) 6, 43, 220
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 2 cut(s) 9, 42
Tru9I TTAA 2 cut(s) 9, 42
XcmI CCANNNNNNNNNTGG 1 cut(s) 226
XspI CTAG 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.