Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8503039.1

Orthogroup ID

OG0002780

Physical Location & Seq

Genomic Coordinates Reverse (-)

877 .. 2307

Gene Structure 1431 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8503039.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 507 bp

atgagatgctttgtcaaagggttaaccaatagtccacttttacaatcttctggcgattccgaatgtaataatgaccccggagatggtggtgggattctagtcttcacattttggtcgatctcttgctttgagaaagtggcggaggagcttgtccatatgcttatattggaactaaatttgaagcgtttgcttgtggtggacttactgtcagttagttgcaaagttccaacggctaacagtttgcattggtctgaagagctatatccaggagaatttggtgatttgagtatatgcaacttattatctgaggaaacttgtaaaccagtctatccaagattgcatggtcagaaatctgataagccagttattggacgtaatcagcagccggatcatgatgttttgcaggtttatctaacaacatggctcatagaggtgaacattgatactgacagggtggatgaaatatttgctgaagttggggaggaaatacattgtaggatttcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

168

Amino Acids

18.86

Weight (kDa)

4.64

Isoelectric Point (pI)

48.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002780)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G07950
fragaria_vesca	FvH4_5g14050 FvH4_5g14050 FvH4_5g14050 FvH4_5g14050 FvH4_5g14150
malus_domestica	MD14G1210300.v1.1 MD17G1029400.v1.1
prunus_persica	Prupe.1G213800_v2.0.a1 Prupe.1G213800_v2.0.a1 Prupe.7G041400_v2.0.a1 Prupe.7G041400_v2.0.a1 Prupe.7G041400_v2.0.a1 Prupe.7G041400_v2.0.a1
pyrus_communis	pycom17g02660
rosa_chinensis	RchiOBHm_Chr4g0399581 RchiOBHm_Chr7g0182771
rosa_laevigata	RLG00000005101 RLG00000009261
rosa_multiflora	Rmu_co8503039.1_g000001 Rmu_sc0000014.1_g000030 Rmu_sc0002285.1_g000035 Rmu_sc0024464.1_g000001
rosa_roxburghii	Rroxscaffold_3G00270990 Rroxscaffold_5G00344490
rosa_rugosa	Rorug04G0017400 Rorug06G0450100 Rorug06G0450200 Rorug06G0450300
rosa_samantha	Rh4AG095300 Rh4BG092700 Rh4CG103800 Rh4DG087700 Rh7AG053900 Rh7BG053400 Rh7CG055000 Rh7DG053200
rosa_wichuraiana	Rw4G007840 Rw7G004390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	394
AccB7I	CCANNNNNTGG	1 cut(s)	368
AciI	CCGC	1 cut(s)	140
AclWI	GGATC	1 cut(s)	396
AcsI	RAATTY	2 cut(s)	175, 272
AcuI	CTGAAG	2 cut(s)	273, 492
AfiI	CCNNNNNNNGG	2 cut(s)	83, 368
AgsI	TTSAA	1 cut(s)	181
AhdI	GACNNNNNGTC	1 cut(s)	205
AjnI	CCWGG	1 cut(s)	265
AluBI	AGCT	2 cut(s)	148, 259
AluI	AGCT	2 cut(s)	148, 259
AlwI	GGATC	1 cut(s)	396
ApeKI	GCWGC	1 cut(s)	382
ApoI	RAATTY	2 cut(s)	175, 272
AsuC2I	CCSGG	1 cut(s)	78
AsuHPI	GGTGA	2 cut(s)	290, 445
BbsI	GAAGAC	1 cut(s)	94
BbvI	GCAGC	1 cut(s)	394
BccI	CCATC	1 cut(s)	77
BceAI	ACGGC	1 cut(s)	246
BciT130I	CCWGG	1 cut(s)	267
BcnI	CCSGG	1 cut(s)	78
BfaI	CTAG	1 cut(s)	98
BfuAI	ACCTGC	1 cut(s)	394
BisI	GCNGC	1 cut(s)	383
BlsI	GCNGC	1 cut(s)	384
Bme1390I	CCNGG	2 cut(s)	78, 267
BmeRI	GACNNNNNGTC	1 cut(s)	205
BmrFI	CCNGG	2 cut(s)	78, 267
BpiI	GAAGAC	1 cut(s)	94
BpuMI	CCSGG	1 cut(s)	78
BsaJI	CCNNGG	1 cut(s)	76
Bsc4I	CCNNNNNNNGG	2 cut(s)	83, 368
Bse1I	ACTGG	2 cut(s)	323, 362
BseBI	CCWGG	1 cut(s)	267
BseDI	CCNNGG	1 cut(s)	76
BseGI	GGATG	1 cut(s)	463
BseLI	CCNNNNNNNGG	2 cut(s)	83, 368
BseMII	CTCAG	1 cut(s)	297
BseNI	ACTGG	2 cut(s)	323, 362
BseRI	GAGGAG	1 cut(s)	158
BseXI	GCAGC	1 cut(s)	394
BsiSI	CCGG	2 cut(s)	78, 386
BslI	CCNNNNNNNGG	2 cut(s)	83, 368
Bsp143I	GATC	2 cut(s)	117, 388
BspACI	CCGC	1 cut(s)	140
BspCNI	CTCAG	1 cut(s)	298
BspHI	TCATGA	2 cut(s)	391, 503
BspMI	ACCTGC	1 cut(s)	394
BspPI	GGATC	1 cut(s)	396
BspQI	GCTCTTC	1 cut(s)	249
BsrI	ACTGG	2 cut(s)	323, 362
BssECI	CCNNGG	1 cut(s)	76
BssMI	GATC	2 cut(s)	117, 388
Bst2UI	CCWGG	1 cut(s)	267
Bst4CI	ACNGT	2 cut(s)	207, 239
Bst6I	CTCTTC	1 cut(s)	249
BstDEI	CTNAG	1 cut(s)	306
BstF5I	GGATG	1 cut(s)	463
BstKTI	GATC	2 cut(s)	120, 391
BstMBI	GATC	2 cut(s)	117, 388
BstNI	CCWGG	1 cut(s)	267
BstSCI	CCNGG	2 cut(s)	76, 265
BstV1I	GCAGC	1 cut(s)	394
BstV2I	GAAGAC	1 cut(s)	94
BtsCI	GGATG	1 cut(s)	463
BveI	ACCTGC	1 cut(s)	394
CciI	TCATGA	2 cut(s)	391, 503
CviAII	CATG	4 cut(s)	341, 392, 420, 504
CviJI	RGCY	6 cut(s)	148, 233, 259, 361, 385, 424
CviKI_1	RGCY	6 cut(s)	148, 233, 259, 361, 385, 424
DdeI	CTNAG	1 cut(s)	306
DpnI	GATC	2 cut(s)	119, 390
DpnII	GATC	2 cut(s)	117, 388
DriI	GACNNNNNGTC	1 cut(s)	205
Eam1104I	CTCTTC	1 cut(s)	249
Eam1105I	GACNNNNNGTC	1 cut(s)	205
EarI	CTCTTC	1 cut(s)	249
EciI	GGCGGA	1 cut(s)	155
Eco57I	CTGAAG	2 cut(s)	273, 492
EcoRII	CCWGG	1 cut(s)	265
FaeI	CATG	4 cut(s)	344, 395, 423, 507
FatI	CATG	4 cut(s)	340, 391, 419, 503
FauNDI	CATATG	1 cut(s)	156
Fnu4HI	GCNGC	1 cut(s)	383
FokI	GGATG	1 cut(s)	470
Fsp4HI	GCNGC	1 cut(s)	383
FspBI	CTAG	1 cut(s)	98
GluI	GCNGC	1 cut(s)	383
HapII	CCGG	2 cut(s)	78, 386
Hin1II	CATG	4 cut(s)	344, 395, 423, 507
HincII	GTYRAC	1 cut(s)	24
HindII	GTYRAC	1 cut(s)	24
HinfI	GANTC	2 cut(s)	56, 94
HpaI	GTTAAC	1 cut(s)	24
HpaII	CCGG	2 cut(s)	78, 386
HphI	GGTGA	2 cut(s)	290, 445
Hpy166II	GTNNAC	5 cut(s)	24, 35, 199, 320, 436
Hpy188I	TCNGA	5 cut(s)	61, 253, 307, 348, 355
Hpy188III	TCNNGA	2 cut(s)	392, 504
Hpy8I	GTNNAC	5 cut(s)	24, 35, 199, 320, 436
HpyCH4III	ACNGT	2 cut(s)	207, 239
HpyCH4IV	ACGT	1 cut(s)	373
HpyCH4V	TGCA	5 cut(s)	219, 244, 294, 340, 403
HpyF3I	CTNAG	1 cut(s)	306
HpySE526I	ACGT	1 cut(s)	373
Hsp92II	CATG	4 cut(s)	344, 395, 423, 507
KspAI	GTTAAC	1 cut(s)	24
Kzo9I	GATC	2 cut(s)	117, 388
LguI	GCTCTTC	1 cut(s)	249
LmnI	GCTCC	1 cut(s)	145
LpnPI	CCDG	9 cut(s)	36, 91, 252, 279, 336, 375, 389, 399, 436
Lsp1109I	GCAGC	1 cut(s)	394
MaeI	CTAG	1 cut(s)	98
MaeII	ACGT	1 cut(s)	373
MalI	GATC	2 cut(s)	119, 390
MboI	GATC	2 cut(s)	117, 388
MboII	GAAGA	3 cut(s)	39, 94, 266
MluCI	AATT	2 cut(s)	175, 272
MmeI	TCCRAC	1 cut(s)	251
MnlI	CCTC	4 cut(s)	136, 301, 424, 475
MseI	TTAA	1 cut(s)	23
MslI	CAYNNNNRTG	1 cut(s)	431
MspI	CCGG	2 cut(s)	78, 386
MspR9I	CCNGG	2 cut(s)	78, 267
MvaI	CCWGG	1 cut(s)	267
NciI	CCSGG	1 cut(s)	78
NdeI	CATATG	1 cut(s)	156
NdeII	GATC	2 cut(s)	117, 388
NlaIII	CATG	4 cut(s)	344, 395, 423, 507
PagI	TCATGA	2 cut(s)	391, 503
PciSI	GCTCTTC	1 cut(s)	249
PfeI	GAWTC	2 cut(s)	56, 94
PflMI	CCANNNNNTGG	1 cut(s)	368
PfoI	TCCNGGA	1 cut(s)	265
PkrI	GCNGC	1 cut(s)	384
Psp6I	CCWGG	1 cut(s)	265
PspGI	CCWGG	1 cut(s)	265
RseI	CAYNNNNRTG	1 cut(s)	431
SapI	GCTCTTC	1 cut(s)	249
SaqAI	TTAA	1 cut(s)	23
SatI	GCNGC	1 cut(s)	383
Sau3AI	GATC	2 cut(s)	117, 388
ScrFI	CCNGG	2 cut(s)	78, 267
SetI	ASST	5 cut(s)	150, 261, 376, 408, 435
SmiMI	CAYNNNNRTG	1 cut(s)	431
Sse9I	AATT	2 cut(s)	175, 272
SsiI	CCGC	1 cut(s)	140
SspI	AATATT	1 cut(s)	465
SspMI	CTAG	1 cut(s)	98
StyD4I	CCNGG	2 cut(s)	76, 265
TaaI	ACNGT	2 cut(s)	207, 239
TaiI	ACGT	1 cut(s)	376
TaqI	TCGA	1 cut(s)	116
TasI	AATT	2 cut(s)	175, 272
TfiI	GAWTC	2 cut(s)	56, 94
Tru1I	TTAA	1 cut(s)	23
Tru9I	TTAA	1 cut(s)	23
TseI	GCWGC	1 cut(s)	382
TspDTI	ATGAA	2 cut(s)	474, 492
Van91I	CCANNNNNTGG	1 cut(s)	368
XapI	RAATTY	2 cut(s)	175, 272
XspI	CTAG	1 cut(s)	98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.