Rmu_sc0024464.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0024464.1
Physical Location & Seq
Reverse (-)
167 .. 3085
2919 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0024464.1_g000001.1.cds

Sequence Viewer

Length: 918 bp
atggaagctctaagcccagcaaccccttacactccgaaatcgacgaacccgaatccccagactccgacacaaagcccatcaccattagcagcgtcgtctgctcggctgtggaggcccaccgcgcagcgcaacctgagaaaccagtggtccaagctagcttctttaagacaacaatgggagtctgcttcttctagcggaagagcatacgcaacgttgctcgtaaactcctacctttccatcaagtacatgccttcaagggagttgggggttctcagcgacatgccggatatactaaagaaagcttcacagaaattgcttaagcagcaggaacttcatcggagcaagcttttatcatcatacaaggacatggtgtctgttgtaactaatatggtcaaaactagtagatccatgagatgctttgtcaaagggtcgagcaatagtccacttttacaattttctggctattccgaatgtaataatgaccctggagatggtggtgggattccagtcttcacattttggtcgatctcttgctttgagaaagtggcggaggagcttgtccatatgcttatattggaactaaatttgaagcgtttgcttgtggtggacttactgtcagttagttgcaaagttccaacggcaaacagtttgcattggtctgaagagctttatccaggagaatttggtgatttgagtatgtgcaacttattatctgaggaaacttgtaaaccagtctatccaagattgaatggtcagaaatctgataagccaactattcgacgtaatcatcagcagccgaatcatgatgttttgcaggtttatctaacaacatggcgcatagaggtgaacattgatactcacagggtggatgaaatatttgctgaagttggggaggaaatacactgtagactttcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

305

Amino Acids

34.39

Weight (kDa)

8.61

Isoelectric Point (pI)

54.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 805
AccI GTMKAC 1 cut(s) 907
AccII CGCG 1 cut(s) 122
AciI CCGC 3 cut(s) 120, 195, 548
AclI AACGTT 1 cut(s) 212
AclWI GGATC 1 cut(s) 399
AcsI RAATTY 2 cut(s) 583, 680
AcuI CTGAAG 2 cut(s) 681, 903
AdeI CACNNNGTG 1 cut(s) 865
AfaI GTAC 1 cut(s) 245
AfiI CCNNNNNNNGG 1 cut(s) 491
AflII CTTAAG 1 cut(s) 317
AgsI TTSAA 3 cut(s) 255, 589, 748
AhdI GACNNNNNGTC 2 cut(s) 370, 613
AhlI ACTAGT 1 cut(s) 398
AjnI CCWGG 2 cut(s) 484, 673
AluBI AGCT 7 cut(s) 8, 154, 158, 302, 346, 556, 667
AluI AGCT 7 cut(s) 8, 154, 158, 302, 346, 556, 667
AlwI GGATC 1 cut(s) 399
AoxI GGCC 1 cut(s) 113
ApeKI GCWGC 4 cut(s) 89, 124, 322, 793
ApoI RAATTY 2 cut(s) 583, 680
AspLEI GCGC 3 cut(s) 124, 129, 837
AspS9I GGNCC 2 cut(s) 114, 147
AsuHPI GGTGA 3 cut(s) 72, 698, 856
AsuNHI GCTAGC 1 cut(s) 154
AvaII GGWCC 1 cut(s) 147
BbsI GAAGAC 1 cut(s) 502
BbvI GCAGC 4 cut(s) 101, 136, 334, 805
BccI CCATC 3 cut(s) 85, 245, 485
BceAI ACGGC 1 cut(s) 654
BciT130I CCWGG 2 cut(s) 486, 675
BcuI ACTAGT 1 cut(s) 398
BfaI CTAG 3 cut(s) 155, 192, 399
BfmI CTRYAG 1 cut(s) 904
BfrI CTTAAG 1 cut(s) 317
BfuAI ACCTGC 1 cut(s) 805
BisI GCNGC 4 cut(s) 90, 125, 323, 794
BlsI GCNGC 4 cut(s) 91, 126, 324, 795
Bme1390I CCNGG 2 cut(s) 486, 675
Bme18I GGWCC 1 cut(s) 147
BmeRI GACNNNNNGTC 2 cut(s) 370, 613
BmgT120I GGNCC 2 cut(s) 114, 147
BmrFI CCNGG 2 cut(s) 486, 675
BmsI GCATC 1 cut(s) 404
BmtI GCTAGC 1 cut(s) 158
BpiI GAAGAC 1 cut(s) 502
BpmI CTGGAG 1 cut(s) 507
BsaJI CCNNGG 1 cut(s) 484
Bsc4I CCNNNNNNNGG 1 cut(s) 491
Bse1I ACTGG 3 cut(s) 142, 506, 731
BseBI CCWGG 2 cut(s) 486, 675
BseDI CCNNGG 1 cut(s) 484
BseGI GGATG 1 cut(s) 874
BseLI CCNNNNNNNGG 1 cut(s) 491
BseMII CTCAG 3 cut(s) 125, 286, 705
BseNI ACTGG 3 cut(s) 142, 506, 731
BseRI GAGGAG 1 cut(s) 566
BseXI GCAGC 4 cut(s) 101, 136, 334, 805
BseYI CCCAGC 1 cut(s) 16
Bsh1236I CGCG 1 cut(s) 122
BshFI GGCC 1 cut(s) 115
BsiSI CCGG 1 cut(s) 284
BslI CCNNNNNNNGG 1 cut(s) 491
BsnI GGCC 1 cut(s) 115
Bsp143I GATC 2 cut(s) 404, 525
BspACI CCGC 3 cut(s) 120, 195, 548
BspANI GGCC 1 cut(s) 115
BspCNI CTCAG 3 cut(s) 126, 285, 706
BspFNI CGCG 1 cut(s) 122
BspHI TCATGA 2 cut(s) 802, 914
BspMI ACCTGC 1 cut(s) 805
BspOI GCTAGC 1 cut(s) 158
BspPI GGATC 1 cut(s) 399
BspQI GCTCTTC 2 cut(s) 193, 657
BspTI CTTAAG 1 cut(s) 317
BsrI ACTGG 3 cut(s) 142, 506, 731
BssECI CCNNGG 1 cut(s) 484
BssMI GATC 2 cut(s) 404, 525
Bst2UI CCWGG 2 cut(s) 486, 675
Bst4CI ACNGT 3 cut(s) 615, 647, 905
Bst6I CTCTTC 2 cut(s) 193, 657
BstAFI CTTAAG 1 cut(s) 317
BstC8I GCNNGC 2 cut(s) 156, 344
BstDEI CTNAG 4 cut(s) 11, 134, 272, 714
BstF5I GGATG 1 cut(s) 874
BstFNI CGCG 1 cut(s) 122
BstHHI GCGC 3 cut(s) 124, 129, 837
BstKTI GATC 2 cut(s) 407, 528
BstMBI GATC 2 cut(s) 404, 525
BstMWI GCNNNNNNNGC 4 cut(s) 98, 112, 121, 322
BstNI CCWGG 2 cut(s) 486, 675
BstNSI RCATGY 2 cut(s) 250, 283
BstSCI CCNGG 2 cut(s) 484, 673
BstSFI CTRYAG 1 cut(s) 904
BstUI CGCG 1 cut(s) 122
BstV1I GCAGC 4 cut(s) 101, 136, 334, 805
BstV2I GAAGAC 1 cut(s) 502
BstX2I RGATCY 1 cut(s) 404
BstYI RGATCY 1 cut(s) 404
BsuRI GGCC 1 cut(s) 115
BtsCI GGATG 1 cut(s) 874
BtsIMutI CAGTG 2 cut(s) 149, 901
BveI ACCTGC 1 cut(s) 805
Cac8I GCNNGC 2 cut(s) 156, 344
CciI TCATGA 2 cut(s) 802, 914
CfoI GCGC 3 cut(s) 124, 129, 837
Cfr13I GGNCC 2 cut(s) 114, 147
CseI GACGC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 244
CviAII CATG 7 cut(s) 247, 280, 367, 409, 803, 831, 915
CviQI GTAC 1 cut(s) 244
DdeI CTNAG 4 cut(s) 11, 134, 272, 714
DpnI GATC 2 cut(s) 406, 527
DpnII GATC 2 cut(s) 404, 525
DraIII CACNNNGTG 1 cut(s) 865
DriI GACNNNNNGTC 2 cut(s) 370, 613
Eam1104I CTCTTC 2 cut(s) 193, 657
Eam1105I GACNNNNNGTC 2 cut(s) 370, 613
EarI CTCTTC 2 cut(s) 193, 657
EciI GGCGGA 1 cut(s) 563
Eco47I GGWCC 1 cut(s) 147
Eco57I CTGAAG 2 cut(s) 681, 903
EcoRII CCWGG 2 cut(s) 484, 673
FaeI CATG 7 cut(s) 250, 283, 370, 412, 806, 834, 918
FatI CATG 7 cut(s) 246, 279, 366, 408, 802, 830, 914
FauNDI CATATG 1 cut(s) 564
FblI GTMKAC 1 cut(s) 907
Fnu4HI GCNGC 4 cut(s) 90, 125, 323, 794
FokI GGATG 1 cut(s) 881
Fsp4HI GCNGC 4 cut(s) 90, 125, 323, 794
FspBI CTAG 3 cut(s) 155, 192, 399
GlaI GCGC 3 cut(s) 123, 128, 836
GluI GCNGC 4 cut(s) 90, 125, 323, 794
GsaI CCCAGC 1 cut(s) 20
GsuI CTGGAG 1 cut(s) 507
HaeIII GGCC 1 cut(s) 115
HapII CCGG 1 cut(s) 284
HgaI GACGC 1 cut(s) 81
HhaI GCGC 3 cut(s) 124, 129, 837
Hin1II CATG 7 cut(s) 250, 283, 370, 412, 806, 834, 918
Hin6I GCGC 3 cut(s) 122, 127, 835
HinP1I GCGC 3 cut(s) 122, 127, 835
HindIII AAGCTT 2 cut(s) 300, 344
HinfI GANTC 5 cut(s) 52, 61, 179, 502, 799
HpaII CCGG 1 cut(s) 284
HphI GGTGA 3 cut(s) 72, 698, 856
Hpy166II GTNNAC 6 cut(s) 223, 443, 607, 728, 847, 908
Hpy188I TCNGA 8 cut(s) 36, 66, 339, 469, 661, 715, 756, 763
Hpy188III TCNNGA 2 cut(s) 803, 915
Hpy8I GTNNAC 6 cut(s) 223, 443, 607, 728, 847, 908
Hpy99I CGWCG 3 cut(s) 46, 97, 783
HpyAV CCTTC 1 cut(s) 261
HpyCH4III ACNGT 3 cut(s) 615, 647, 905
HpyCH4IV ACGT 2 cut(s) 212, 781
HpyCH4V TGCA 4 cut(s) 627, 652, 702, 814
HpyF10VI GCNNNNNNNGC 4 cut(s) 98, 112, 121, 322
HpyF3I CTNAG 4 cut(s) 11, 134, 272, 714
HpySE526I ACGT 2 cut(s) 212, 781
Hsp92II CATG 7 cut(s) 250, 283, 370, 412, 806, 834, 918
HspAI GCGC 3 cut(s) 122, 127, 835
Kzo9I GATC 2 cut(s) 404, 525
LguI GCTCTTC 2 cut(s) 193, 657
LmnI GCTCC 2 cut(s) 339, 553
Lsp1109I GCAGC 4 cut(s) 101, 136, 334, 805
LweI GCATC 1 cut(s) 404
MaeI CTAG 3 cut(s) 155, 192, 399
MaeII ACGT 2 cut(s) 212, 781
MaeIII GTNAC 1 cut(s) 379
MalI GATC 2 cut(s) 406, 527
MboI GATC 2 cut(s) 404, 525
MboII GAAGA 4 cut(s) 180, 210, 502, 674
MflI RGATCY 1 cut(s) 404
MluCI AATT 4 cut(s) 311, 452, 583, 680
MlyI GAGTC 2 cut(s) 55, 188
MmeI TCCRAC 2 cut(s) 89, 659
MnlI CCTC 5 cut(s) 105, 544, 709, 835, 886
MseI TTAA 2 cut(s) 164, 318
MslI CAYNNNNRTG 1 cut(s) 842
MspCI CTTAAG 1 cut(s) 317
MspI CCGG 1 cut(s) 284
MspR9I CCNGG 2 cut(s) 486, 675
MteI GCGCNGCGC 1 cut(s) 125
MvaI CCWGG 2 cut(s) 486, 675
MvnI CGCG 1 cut(s) 122
MwoI GCNNNNNNNGC 4 cut(s) 98, 112, 121, 322
NdeI CATATG 1 cut(s) 564
NdeII GATC 2 cut(s) 404, 525
NheI GCTAGC 1 cut(s) 154
NlaIII CATG 7 cut(s) 250, 283, 370, 412, 806, 834, 918
NmeAIII GCCGAG 1 cut(s) 82
NspI RCATGY 2 cut(s) 250, 283
PagI TCATGA 2 cut(s) 802, 914
PciSI GCTCTTC 2 cut(s) 193, 657
PcsI WCGNNNNNNNCGW 1 cut(s) 47
PfeI GAWTC 3 cut(s) 52, 502, 799
PfoI TCCNGGA 1 cut(s) 673
PkrI GCNGC 4 cut(s) 91, 126, 324, 795
PleI GAGTC 2 cut(s) 55, 187
PpsI GAGTC 2 cut(s) 55, 187
Psp1406I AACGTT 1 cut(s) 212
Psp6I CCWGG 2 cut(s) 484, 673
PspFI CCCAGC 1 cut(s) 16
PspGI CCWGG 2 cut(s) 484, 673
PspPI GGNCC 2 cut(s) 114, 147
PsuI RGATCY 1 cut(s) 404
RsaI GTAC 1 cut(s) 245
RsaNI GTAC 1 cut(s) 244
RseI CAYNNNNRTG 1 cut(s) 842
SapI GCTCTTC 2 cut(s) 193, 657
SaqAI TTAA 2 cut(s) 164, 318
SatI GCNGC 4 cut(s) 90, 125, 323, 794
Sau3AI GATC 2 cut(s) 404, 525
Sau96I GGNCC 2 cut(s) 114, 147
SchI GAGTC 2 cut(s) 55, 188
ScrFI CCNGG 2 cut(s) 486, 675
SfaNI GCATC 1 cut(s) 404
SfcI CTRYAG 1 cut(s) 904
SinI GGWCC 1 cut(s) 147
SmiMI CAYNNNNRTG 1 cut(s) 842
SmlI CTYRAG 1 cut(s) 317
SmoI CTYRAG 1 cut(s) 317
SpeI ACTAGT 1 cut(s) 398
Sse9I AATT 4 cut(s) 311, 452, 583, 680
SsiI CCGC 3 cut(s) 120, 195, 548
SspI AATATT 1 cut(s) 876
SspMI CTAG 3 cut(s) 155, 192, 399
StyD4I CCNGG 2 cut(s) 484, 673
TaaI ACNGT 3 cut(s) 615, 647, 905
TaiI ACGT 2 cut(s) 215, 784
TaqI TCGA 4 cut(s) 41, 431, 524, 778
TasI AATT 4 cut(s) 311, 452, 583, 680
TatI WGTACW 1 cut(s) 243
TfiI GAWTC 3 cut(s) 52, 502, 799
Tru1I TTAA 2 cut(s) 164, 318
Tru9I TTAA 2 cut(s) 164, 318
TscAI CASTG 2 cut(s) 149, 908
TseI GCWGC 4 cut(s) 89, 124, 322, 793
TspDTI ATGAA 3 cut(s) 323, 885, 903
TspRI CASTG 2 cut(s) 149, 908
Vha464I CTTAAG 1 cut(s) 317
VpaK11BI GGWCC 1 cut(s) 147
XapI RAATTY 2 cut(s) 583, 680
XceI RCATGY 2 cut(s) 250, 283
XmiI GTMKAC 1 cut(s) 907
XspI CTAG 3 cut(s) 155, 192, 399
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.