Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000144.1

Orthogroup ID

OG0004486

Physical Location & Seq

Genomic Coordinates Forward (+)

210293 .. 212145

Gene Structure 1853 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000144.1_g000048.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 960 bp

atggggtcgagagctattgcatgttgcattctgttgtcattgttctcagtagctttagctgaatatgtcgatgtcagggttcgaggagtggtttcgatagctagcacagatgacaatttcatatgtgcaaccctggattggtggccaactgataaatgtgattacaatcaatgtccttggggaaaagctggaatttttaatctggatttgaagaacaagaccttgatcaatgcagtaaaggcattcaatacaataaggatcagaattggaggttcattgcaagaccaaattatttataattttggttatggagtgaaagactgcaaccaaatcgtgaaagatggttctgggcctttcttgttccgtggcggttgtcttcagccgaaaagatgggatgagatccatgagttcttcaaccaaacacaagccaaactcttgtttggattgaatgcccttcatgggaagaaagcggaccctaaagacaagattctttgggttggtgattgggacgcaaaaaacgctcgtgatctcatggagtacaccatctcaaagggttaccctgttgagtcatatgagcttggaaacgagttatgtgggagtggggtaggtgcaagaatagaagctgaacaatatgccaaagacatgaaaaagctcaaacaacttgtgacagagttgttcccagatgattgtggtttctccaatgaccgagcttcttcgaggatgaccgaactcagaatcgaggatggggcacaactgaagagctatttgatccccaaacctagagtgaaatctgagagaagcaaaacgaaaagcgaaatcaaaaccagagcaagttccgccaggaaaagattagtatctctgattgccctggctttgaacctggatgagattttttttgagaaagttggggatctgaatggccacttttgcaattcttcaccttttgcaccatccaggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004553 GO:0004566 GO:0005575 GO:0005618 GO:0005623 GO:0009505 GO:0016787 GO:0016798 GO:0030312 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00531 ko01100 ko05205 map00531 map01100 map05205

Pfam Domains

Protein Families

Glyco_hydro_79n

Protein Analysis

319

Amino Acids

35.75

Weight (kDa)

8.7

Isoelectric Point (pI)

31.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004486)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G61250 AT5G61250 AT5G61250
fragaria_vesca	FvH4_4g30431
malus_domestica	MD16G1063800.v1.1
prunus_persica	Prupe.1G282800_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0148001 RchiOBHm_Chr4g0438741 RchiOBHm_Chr5g0048021 RchiOBHm_Chr6g0269401
rosa_laevigata	RLG00000006333
rosa_multiflora	Rmu_co8288403.1_g000001 Rmu_co8425743.1_g000002 Rmu_sc0000144.1_g000048 Rmu_sc0002505.1_g000007 Rmu_sc0003368.1_g000008 Rmu_sc0013774.1_g000001
rosa_roxburghii	Rroxscaffold_5G00379770
rosa_rugosa	Rorug04G0312900
rosa_samantha	Rh1AG210500 Rh2AG598400 Rh4AG363500 Rh4BG374900 Rh4BG375000 Rh4CG389100 Rh4DG369300 Rh5BG325700 Rh5BG370100 Rh5DG336800
rosa_wichuraiana	Rw0G007200 Rw0G016750 Rw1G001110

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	297
AciI	CCGC	3 cut(s)	369, 470, 837
AclWI	GGATC	4 cut(s)	266, 394, 763, 918
AcoI	YGGCCR	2 cut(s)	143, 919
AcsI	RAATTY	1 cut(s)	192
AcuI	CTGAAG	2 cut(s)	362, 776
AfaI	GTAC	1 cut(s)	539
AfiI	CCNNNNNNNGG	2 cut(s)	138, 459
AgsI	TTSAA	5 cut(s)	211, 247, 415, 448, 877
AjnI	CCWGG	5 cut(s)	132, 839, 867, 879, 953
AlwI	GGATC	4 cut(s)	266, 394, 763, 918
AoxI	GGCC	3 cut(s)	143, 350, 919
ApoI	RAATTY	1 cut(s)	192
AspS9I	GGNCC	2 cut(s)	350, 472
AsuHPI	GGTGA	2 cut(s)	512, 930
AsuNHI	GCTAGC	1 cut(s)	101
AvaII	GGWCC	1 cut(s)	472
BaeGI	GKGCMC	1 cut(s)	751
BalI	TGGCCA	2 cut(s)	145, 921
BauI	CACGAG	1 cut(s)	522
BbsI	GAAGAC	1 cut(s)	368
BccI	CCATC	5 cut(s)	335, 384, 551, 737, 958
BcgI	CGANNNNNNTGC	2 cut(s)	313, 347
BciT130I	CCWGG	5 cut(s)	134, 841, 869, 881, 955
BclI	TGATCA	1 cut(s)	225
BfaI	CTAG	2 cut(s)	102, 780
Bme1390I	CCNGG	5 cut(s)	134, 841, 869, 881, 955
Bme18I	GGWCC	1 cut(s)	472
BmgT120I	GGNCC	2 cut(s)	350, 472
BmiI	GGNNCC	1 cut(s)	474
BmrFI	CCNGG	5 cut(s)	134, 841, 869, 881, 955
BmtI	GCTAGC	1 cut(s)	105
BpiI	GAAGAC	1 cut(s)	368
BsaBI	GATNNNNATC	2 cut(s)	165, 853
BsaJI	CCNNGG	4 cut(s)	132, 176, 364, 867
Bsc4I	CCNNNNNNNGG	2 cut(s)	138, 459
Bse3DI	GCAATG	1 cut(s)	275
Bse8I	GATNNNNATC	2 cut(s)	165, 853
BseBI	CCWGG	5 cut(s)	134, 841, 869, 881, 955
BseDI	CCNNGG	4 cut(s)	132, 176, 364, 867
BseGI	GGATG	5 cut(s)	400, 726, 748, 889, 950
BseJI	GATNNNNATC	2 cut(s)	165, 853
BseLI	CCNNNNNNNGG	2 cut(s)	138, 459
BseMI	GCAATG	1 cut(s)	275
BseMII	CTCAG	3 cut(s)	60, 745, 783
BseRI	GAGGAG	1 cut(s)	99
BseSI	GKGCMC	1 cut(s)	751
BshFI	GGCC	3 cut(s)	145, 352, 921
BslFI	GGGAC	1 cut(s)	521
BslI	CCNNNNNNNGG	2 cut(s)	138, 459
BsmFI	GGGAC	1 cut(s)	521
BsmI	GAATGC	3 cut(s)	27, 242, 454
BsnI	GGCC	3 cut(s)	145, 352, 921
Bsp1286I	GDGCHC	1 cut(s)	751
Bsp143I	GATC	6 cut(s)	225, 258, 399, 526, 768, 910
BspACI	CCGC	3 cut(s)	369, 470, 837
BspANI	GGCC	3 cut(s)	145, 352, 921
BspCNI	CTCAG	3 cut(s)	59, 744, 784
BspLI	GGNNCC	1 cut(s)	474
BspOI	GCTAGC	1 cut(s)	105
BspPI	GGATC	4 cut(s)	266, 394, 763, 918
BspQI	GCTCTTC	1 cut(s)	752
BsrDI	GCAATG	1 cut(s)	275
BssECI	CCNNGG	4 cut(s)	132, 176, 364, 867
BssMI	GATC	6 cut(s)	225, 258, 399, 526, 768, 910
BssSI	CACGAG	1 cut(s)	522
BssT1I	CCWWGG	1 cut(s)	176
Bst2BI	CACGAG	1 cut(s)	522
Bst2UI	CCWGG	5 cut(s)	134, 841, 869, 881, 955
Bst6I	CTCTTC	1 cut(s)	752
BstC8I	GCNNGC	1 cut(s)	103
BstDEI	CTNAG	3 cut(s)	46, 731, 792
BstDSI	CCRYGG	1 cut(s)	364
BstEII	GGTNACC	1 cut(s)	554
BstF5I	GGATG	5 cut(s)	400, 726, 748, 889, 950
BstKTI	GATC	6 cut(s)	228, 261, 402, 529, 771, 913
BstMBI	GATC	6 cut(s)	225, 258, 399, 526, 768, 910
BstMWI	GCNNNNNNNGC	4 cut(s)	239, 518, 836, 927
BstNI	CCWGG	5 cut(s)	134, 841, 869, 881, 955
BstNSI	RCATGY	1 cut(s)	24
BstPI	GGTNACC	1 cut(s)	554
BstSCI	CCNGG	5 cut(s)	132, 839, 867, 879, 953
BstSLI	GKGCMC	1 cut(s)	751
BstV2I	GAAGAC	1 cut(s)	368
BstX2I	RGATCY	2 cut(s)	399, 910
BstYI	RGATCY	2 cut(s)	399, 910
BsuRI	GGCC	3 cut(s)	145, 352, 921
BtgI	CCRYGG	1 cut(s)	364
BtsCI	GGATG	5 cut(s)	400, 726, 748, 889, 950
Cac8I	GCNNGC	1 cut(s)	103
Cfr13I	GGNCC	2 cut(s)	350, 472
CseI	GACGC	1 cut(s)	518
Csp6I	GTAC	1 cut(s)	538
CviAII	CATG	5 cut(s)	21, 404, 458, 532, 643
CviQI	GTAC	1 cut(s)	538
DdeI	CTNAG	3 cut(s)	46, 731, 792
DpnI	GATC	6 cut(s)	227, 260, 401, 528, 770, 912
DpnII	GATC	6 cut(s)	225, 258, 399, 526, 768, 910
EaeI	YGGCCR	2 cut(s)	143, 919
Eam1104I	CTCTTC	1 cut(s)	752
EarI	CTCTTC	1 cut(s)	752
EciI	GGCGGA	1 cut(s)	826
Eco130I	CCWWGG	1 cut(s)	176
Eco47I	GGWCC	1 cut(s)	472
Eco57I	CTGAAG	2 cut(s)	362, 776
Eco91I	GGTNACC	1 cut(s)	554
EcoO65I	GGTNACC	1 cut(s)	554
EcoRII	CCWGG	5 cut(s)	132, 839, 867, 879, 953
EcoT14I	CCWWGG	1 cut(s)	176
ErhI	CCWWGG	1 cut(s)	176
FaeI	CATG	5 cut(s)	24, 407, 461, 535, 646
FaqI	GGGAC	1 cut(s)	521
FatI	CATG	5 cut(s)	20, 403, 457, 531, 642
FauNDI	CATATG	2 cut(s)	122, 571
FbaI	TGATCA	1 cut(s)	225
FokI	GGATG	5 cut(s)	407, 733, 755, 896, 937
FspBI	CTAG	2 cut(s)	102, 780
HaeIII	GGCC	3 cut(s)	145, 352, 921
HgaI	GACGC	1 cut(s)	518
Hin1II	CATG	5 cut(s)	24, 407, 461, 535, 646
HinfI	GANTC	3 cut(s)	487, 566, 735
HphI	GGTGA	2 cut(s)	512, 930
Hpy166II	GTNNAC	1 cut(s)	540
Hpy188I	TCNGA	5 cut(s)	263, 734, 793, 861, 915
Hpy188III	TCNNGA	4 cut(s)	9, 203, 334, 524
Hpy8I	GTNNAC	1 cut(s)	540
HpyAV	CCTTC	1 cut(s)	464
HpyCH4V	TGCA	9 cut(s)	20, 27, 128, 233, 280, 324, 611, 930, 947
HpyF10VI	GCNNNNNNNGC	4 cut(s)	239, 518, 836, 927
HpyF3I	CTNAG	3 cut(s)	46, 731, 792
Hsp92II	CATG	5 cut(s)	24, 407, 461, 535, 646
Ksp22I	TGATCA	1 cut(s)	225
Kzo9I	GATC	6 cut(s)	225, 258, 399, 526, 768, 910
LguI	GCTCTTC	1 cut(s)	752
MaeI	CTAG	2 cut(s)	102, 780
MaeIII	GTNAC	2 cut(s)	554, 664
MalI	GATC	6 cut(s)	227, 260, 401, 528, 770, 912
MboI	GATC	6 cut(s)	225, 258, 399, 526, 768, 910
MboII	GAAGA	7 cut(s)	223, 368, 403, 475, 705, 769, 927
MflI	RGATCY	2 cut(s)	399, 910
MhlI	GDGCHC	1 cut(s)	751
MlsI	TGGCCA	2 cut(s)	145, 921
MluCI	AATT	6 cut(s)	115, 192, 264, 288, 298, 931
MluNI	TGGCCA	2 cut(s)	145, 921
MlyI	GAGTC	1 cut(s)	575
MnlI	CCTC	4 cut(s)	77, 263, 711, 733
Mox20I	TGGCCA	2 cut(s)	145, 921
MscI	TGGCCA	2 cut(s)	145, 921
MseI	TTAA	1 cut(s)	198
MslI	CAYNNNNRTG	1 cut(s)	955
Msp20I	TGGCCA	2 cut(s)	145, 921
MspR9I	CCNGG	5 cut(s)	134, 841, 869, 881, 955
Mva1269I	GAATGC	3 cut(s)	27, 242, 454
MvaI	CCWGG	5 cut(s)	134, 841, 869, 881, 955
MwoI	GCNNNNNNNGC	4 cut(s)	239, 518, 836, 927
NdeI	CATATG	2 cut(s)	122, 571
NdeII	GATC	6 cut(s)	225, 258, 399, 526, 768, 910
NheI	GCTAGC	1 cut(s)	101
NlaIII	CATG	5 cut(s)	24, 407, 461, 535, 646
NlaIV	GGNNCC	1 cut(s)	474
NmuCI	GTSAC	1 cut(s)	664
NspI	RCATGY	1 cut(s)	24
PciSI	GCTCTTC	1 cut(s)	752
PctI	GAATGC	3 cut(s)	27, 242, 454
PfeI	GAWTC	2 cut(s)	487, 735
PleI	GAGTC	1 cut(s)	574
PpsI	GAGTC	1 cut(s)	574
PsiI	TTATAA	1 cut(s)	297
Psp6I	CCWGG	5 cut(s)	132, 839, 867, 879, 953
PspEI	GGTNACC	1 cut(s)	554
PspGI	CCWGG	5 cut(s)	132, 839, 867, 879, 953
PspN4I	GGNNCC	1 cut(s)	474
PspPI	GGNCC	2 cut(s)	350, 472
PsuI	RGATCY	2 cut(s)	399, 910
RsaI	GTAC	1 cut(s)	539
RsaNI	GTAC	1 cut(s)	538
RseI	CAYNNNNRTG	1 cut(s)	955
SapI	GCTCTTC	1 cut(s)	752
SaqAI	TTAA	1 cut(s)	198
Sau3AI	GATC	6 cut(s)	225, 258, 399, 526, 768, 910
Sau96I	GGNCC	2 cut(s)	350, 472
SchI	GAGTC	1 cut(s)	575
ScrFI	CCNGG	5 cut(s)	134, 841, 869, 881, 955
SduI	GDGCHC	1 cut(s)	751
SinI	GGWCC	1 cut(s)	472
SmiMI	CAYNNNNRTG	1 cut(s)	955
Sse9I	AATT	6 cut(s)	115, 192, 264, 288, 298, 931
SsiI	CCGC	3 cut(s)	369, 470, 837
SspMI	CTAG	2 cut(s)	102, 780
StyD4I	CCNGG	5 cut(s)	132, 839, 867, 879, 953
StyI	CCWWGG	1 cut(s)	176
TaqI	TCGA	6 cut(s)	8, 69, 82, 95, 716, 738
TaqII	GACCGA	2 cut(s)	720, 740
TasI	AATT	6 cut(s)	115, 192, 264, 288, 298, 931
TatI	WGTACW	1 cut(s)	537
TfiI	GAWTC	2 cut(s)	487, 735
Tru1I	TTAA	1 cut(s)	198
Tru9I	TTAA	1 cut(s)	198
TseFI	GTSAC	1 cut(s)	664
Tsp45I	GTSAC	1 cut(s)	664
TspDTI	ATGAA	4 cut(s)	109, 264, 446, 659
TspGWI	ACGGA	1 cut(s)	353
VpaK11BI	GGWCC	1 cut(s)	472
XapI	RAATTY	1 cut(s)	192
XceI	RCATGY	1 cut(s)	24
XspI	CTAG	2 cut(s)	102, 780

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.