Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000536.1

Orthogroup ID

OG0001920

Physical Location & Seq

Genomic Coordinates Reverse (-)

72203 .. 75171

Gene Structure 2969 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000536.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1218 bp

atggtgagccgaagaacccgaggtcccaaacccgccgccgacggcgacgatgaaaccggaagcggagacaacgcagccgcagaggtttcggactacgagcaaatcagagaccaacggatcaaagagaacaaggagcggatgcagaagctgggcattttcgacctttcactccagctcaagtccaaaccctccgccgcttcaaaacgcggccgtccgttgaaggacccttccgatcagaccaaaatcataaccaaaacctctctctccccagcaaggcgttcctctaggttgaagactctggctccggtgagttatgtggagattaggcccaaagggaagagggagtcttcgtggaatggtgagattaatatcaaggagggtataaggccagagatttatagtgatgagcatgaaaagctattgggggattgtaaggagacttgggaactctcggttgatgggtatggagaagacgggaagcggatttatgatccggttaagggtgaaacttgccaccaatgcaggtggctcatatggggtgaaccaaatggtgagattaatatcaaggagggtataaggccagagatttatagtgatgagcatgaaaagctattgggggattgtaaggagacttgggaactctcggttgatgggtatggagaagacgggaagcggatttatgatccggttaagggtgaaacttgccaccaatgcaggcagaaaactcttggtcagcatacacattgctgcaaatgtgacttggtccaagggcagttttgtggagattgcttatacatgagatatggagagaatgtgatcgaagccagcaaaaatcctgattgggtttgccctgtttgtcggggcatttgcaactgcagtctttgccgtaaagaaaaagggtgggagcccactggtaatctgtataggaaggtcataaatctgggttacaagtctgtggcacattatcttattcaaacccgtcgttcccaacgaaaatcagaaacctcaggtgcagaggaatcaatgcatgatgatatgaaacaagaaacagaagaggcacacttaacagggggagaagaaatggaagaggttcagtgtgttgatgccaaagagttgggtaacatagatgatactggtgctgccgttgctggggattcagttgaaggtgagacaaagggaaagctgagaaggaggagcacaaggttgaggaagaactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-4CXXC_R1

Protein Analysis

405

Amino Acids

45.75

Weight (kDa)

6.22

Isoelectric Point (pI)

45.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001920)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G37110 AT4G37110 AT4G37110 AT4G37110
fragaria_vesca	FvH4_1g14770 FvH4_1g14770 FvH4_1g14770 FvH4_2g07200 FvH4_2g07200
malus_domestica	MD02G1160900.v1.1 MD05G1072600.v1.1 MD10G1087200.v1.1 MD10G1087400.v1.1 MD15G1275000.v1.1
prunus_persica	Prupe.7G142700_v2.0.a1 Prupe.7G142700_v2.0.a1 Prupe.8G113300_v2.0.a1 Prupe.8G113300_v2.0.a1 Prupe.8G113400_v2.0.a1 Prupe.8G113400_v2.0.a1
pyrus_communis	pycom02g12700 pycom05g06480 pycom10g06970 pycom10g08140 pycom15g23810
rosa_chinensis	RchiOBHm_Chr2g0103711 RchiOBHm_Chr6g0259631 RchiOBHm_Chr6g0259651
rosa_laevigata	RLG00000014516 RLG00000017251
rosa_multiflora	Rmu_sc0000536.1_g000015
rosa_roxburghii	Rroxscaffold_2G00139460 Rroxscaffold_7G00206930
rosa_rugosa	Rorug02G0116800 Rorug05G0590100
rosa_samantha	Rh2AG165600 Rh2BG172900 Rh2CG171600 Rh2DG171200 Rh6AG106300 Rh6BG100800 Rh6BG100900 Rh6CG095400 Rh6DG089300
rosa_wichuraiana	Rw2G012970 Rw6G009190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	513
Acc36I	ACCTGC	1 cut(s)	513
AccBSI	CCGCTC	1 cut(s)	136
AccII	CGCG	1 cut(s)	207
AclWI	GGATC	3 cut(s)	125, 485, 677
AcoI	YGGCCR	1 cut(s)	208
AfiI	CCNNNNNNNGG	4 cut(s)	273, 500, 692, 1149
AgsI	TTSAA	5 cut(s)	201, 220, 292, 974, 1163
AloI	GAACNNNNNNTCC	2 cut(s)	7, 39
AluBI	AGCT	5 cut(s)	148, 175, 418, 610, 1183
AluI	AGCT	5 cut(s)	148, 175, 418, 610, 1183
Alw21I	GWGCWC	1 cut(s)	1199
Alw26I	GTCTC	5 cut(s)	60, 102, 431, 623, 1163
AlwI	GGATC	3 cut(s)	125, 485, 677
AlwNI	CAGNNNCTG	1 cut(s)	148
Ama87I	CYCGRG	1 cut(s)	18
AoxI	GGCC	4 cut(s)	208, 326, 386, 578
ApeKI	GCWGC	3 cut(s)	74, 747, 1139
AseI	ATTAAT	2 cut(s)	366, 558
Asp700I	GAANNNNTTC	1 cut(s)	1089
AspS9I	GGNCC	4 cut(s)	23, 223, 327, 763
AsuHPI	GGTGA	8 cut(s)	16, 319, 371, 515, 551, 563, 707, 1178
AvaI	CYCGRG	1 cut(s)	18
AvaII	GGWCC	3 cut(s)	23, 223, 763
AxyI	CCTNAGG	1 cut(s)	1006
BanII	GRGCYC	1 cut(s)	909
BbsI	GAAGAC	4 cut(s)	299, 339, 477, 669
Bbv12I	GWGCWC	1 cut(s)	1199
BbvI	GCAGC	3 cut(s)	86, 734, 1126
BccI	CCATC	2 cut(s)	452, 644
BceAI	ACGGC	4 cut(s)	58, 195, 870, 1127
BcgI	CGANNNNNNTGC	2 cut(s)	69, 103
BcoDI	GTCTC	5 cut(s)	60, 102, 431, 623, 1163
BfaI	CTAG	1 cut(s)	285
BfmI	CTRYAG	1 cut(s)	874
BfuAI	ACCTGC	1 cut(s)	513
BisI	GCNGC	7 cut(s)	36, 75, 78, 195, 208, 748, 1140
BlsI	GCNGC	7 cut(s)	37, 76, 79, 196, 209, 749, 1141
Bme18I	GGWCC	3 cut(s)	23, 223, 763
BmeT110I	CYCGRG	1 cut(s)	18
BmgT120I	GGNCC	4 cut(s)	23, 223, 327, 763
BmiI	GGNNCC	4 cut(s)	25, 225, 303, 906
BmsI	GCATC	2 cut(s)	129, 1093
BpiI	GAAGAC	4 cut(s)	299, 339, 477, 669
BpmI	CTGGAG	1 cut(s)	155
BpuEI	CTTGAG	1 cut(s)	161
BsaBI	GATNNNNATC	2 cut(s)	368, 560
BsaI	GGTCTC	1 cut(s)	102
BsaJI	CCNNGG	2 cut(s)	19, 766
BsaWI	WCCGGW	4 cut(s)	56, 304, 493, 685
BsaXI	ACNNNNNCTCC	6 cut(s)	286, 316, 335, 365, 798, 828
Bsc4I	CCNNNNNNNGG	4 cut(s)	273, 500, 692, 1149
Bse1I	ACTGG	2 cut(s)	916, 1138
Bse21I	CCTNAGG	1 cut(s)	1006
Bse3DI	GCAATG	1 cut(s)	742
Bse8I	GATNNNNATC	2 cut(s)	368, 560
BseDI	CCNNGG	2 cut(s)	19, 766
BseGI	GGATG	1 cut(s)	144
BseJI	GATNNNNATC	2 cut(s)	368, 560
BseLI	CCNNNNNNNGG	4 cut(s)	273, 500, 692, 1149
BseMI	GCAATG	1 cut(s)	742
BseMII	CTCAG	2 cut(s)	1020, 1175
BseNI	ACTGG	2 cut(s)	916, 1138
BseRI	GAGGAG	1 cut(s)	1207
BseX3I	CGGCCG	1 cut(s)	208
BseXI	GCAGC	3 cut(s)	86, 734, 1126
BseYI	CCCAGC	3 cut(s)	148, 268, 1148
BsgI	GTGCAG	1 cut(s)	1032
Bsh1236I	CGCG	1 cut(s)	207
Bsh1285I	CGRYCG	1 cut(s)	211
BshFI	GGCC	4 cut(s)	210, 328, 388, 580
BsiEI	CGRYCG	1 cut(s)	211
BsiHKAI	GWGCWC	1 cut(s)	1199
BsiHKCI	CYCGRG	1 cut(s)	18
BsiSI	CCGG	4 cut(s)	57, 305, 494, 686
BslFI	GGGAC	1 cut(s)	9
BslI	CCNNNNNNNGG	4 cut(s)	273, 500, 692, 1149
BsmAI	GTCTC	5 cut(s)	60, 102, 431, 623, 1163
BsmFI	GGGAC	1 cut(s)	9
BsnI	GGCC	4 cut(s)	210, 328, 388, 580
Bso31I	GGTCTC	1 cut(s)	102
BsoBI	CYCGRG	1 cut(s)	18
Bsp1286I	GDGCHC	2 cut(s)	909, 1199
Bsp143I	GATC	5 cut(s)	117, 232, 490, 682, 816
BspANI	GGCC	4 cut(s)	210, 328, 388, 580
BspCNI	CTCAG	2 cut(s)	1019, 1176
BspFNI	CGCG	1 cut(s)	207
BspLI	GGNNCC	4 cut(s)	25, 225, 303, 906
BspMAI	CTGCAG	1 cut(s)	878
BspMI	ACCTGC	1 cut(s)	513
BspPI	GGATC	3 cut(s)	125, 485, 677
BspTNI	GGTCTC	1 cut(s)	102
BsrBI	CCGCTC	1 cut(s)	136
BsrDI	GCAATG	1 cut(s)	742
BsrI	ACTGG	2 cut(s)	916, 1138
BssECI	CCNNGG	2 cut(s)	19, 766
BssMI	GATC	5 cut(s)	117, 232, 490, 682, 816
BssT1I	CCWWGG	1 cut(s)	766
Bst6I	CTCTTC	3 cut(s)	332, 1047, 1080
BstAPI	GCANNNNNTGC	1 cut(s)	882
BstC8I	GCNNGC	2 cut(s)	716, 826
BstDEI	CTNAG	2 cut(s)	1006, 1184
BstF5I	GGATG	1 cut(s)	144
BstFNI	CGCG	1 cut(s)	207
BstKTI	GATC	5 cut(s)	120, 235, 493, 685, 819
BstMAI	GTCTC	5 cut(s)	60, 102, 431, 623, 1163
BstMBI	GATC	5 cut(s)	117, 232, 490, 682, 816
BstMCI	CGRYCG	1 cut(s)	211
BstMWI	GCNNNNNNNGC	6 cut(s)	415, 519, 607, 711, 882, 1145
BstSFI	CTRYAG	1 cut(s)	874
BstUI	CGCG	1 cut(s)	207
BstV1I	GCAGC	3 cut(s)	86, 734, 1126
BstV2I	GAAGAC	4 cut(s)	299, 339, 477, 669
BstXI	CCANNNNNNTGG	1 cut(s)	1114
BstZI	CGGCCG	1 cut(s)	208
Bsu36I	CCTNAGG	1 cut(s)	1006
BsuRI	GGCC	4 cut(s)	210, 328, 388, 580
BtsCI	GGATG	1 cut(s)	144
BtsIMutI	CAGTG	2 cut(s)	909, 1100
BveI	ACCTGC	1 cut(s)	513
Cac8I	GCNNGC	2 cut(s)	716, 826
CaiI	CAGNNNCTG	1 cut(s)	148
Cfr13I	GGNCC	4 cut(s)	23, 223, 327, 763
CspCI	CAANNNNNGTGG	2 cut(s)	506, 541
CviAII	CATG	4 cut(s)	410, 602, 796, 1028
DdeI	CTNAG	2 cut(s)	1006, 1184
DpnI	GATC	5 cut(s)	119, 234, 492, 684, 818
DpnII	GATC	5 cut(s)	117, 232, 490, 682, 816
EaeI	YGGCCR	1 cut(s)	208
EagI	CGGCCG	1 cut(s)	208
Eam1104I	CTCTTC	3 cut(s)	332, 1047, 1080
EarI	CTCTTC	3 cut(s)	332, 1047, 1080
EciI	GGCGGA	1 cut(s)	181
EclXI	CGGCCG	1 cut(s)	208
Eco130I	CCWWGG	1 cut(s)	766
Eco24I	GRGCYC	1 cut(s)	909
Eco31I	GGTCTC	1 cut(s)	102
Eco47I	GGWCC	3 cut(s)	23, 223, 763
Eco52I	CGGCCG	1 cut(s)	208
Eco81I	CCTNAGG	1 cut(s)	1006
Eco88I	CYCGRG	1 cut(s)	18
EcoO109I	RGGNCCY	2 cut(s)	23, 223
EcoT14I	CCWWGG	1 cut(s)	766
EcoT22I	ATGCAT	1 cut(s)	1029
EcoT38I	GRGCYC	1 cut(s)	909
ErhI	CCWWGG	1 cut(s)	766
FaeI	CATG	4 cut(s)	413, 605, 799, 1031
FaqI	GGGAC	1 cut(s)	9
FatI	CATG	4 cut(s)	409, 601, 795, 1027
FauI	CCCGC	1 cut(s)	40
FauNDI	CATATG	1 cut(s)	533
Fnu4HI	GCNGC	7 cut(s)	36, 75, 78, 195, 208, 748, 1140
FokI	GGATG	1 cut(s)	151
FriOI	GRGCYC	1 cut(s)	909
Fsp4HI	GCNGC	7 cut(s)	36, 75, 78, 195, 208, 748, 1140
FspBI	CTAG	1 cut(s)	285
GluI	GCNGC	7 cut(s)	36, 75, 78, 195, 208, 748, 1140
GsaI	CCCAGC	3 cut(s)	152, 272, 1152
GsuI	CTGGAG	1 cut(s)	155
HaeIII	GGCC	4 cut(s)	210, 328, 388, 580
HapII	CCGG	4 cut(s)	57, 305, 494, 686
Hin1II	CATG	4 cut(s)	413, 605, 799, 1031
HinfI	GANTC	4 cut(s)	295, 344, 1019, 1154
HpaII	CCGG	4 cut(s)	57, 305, 494, 686
HphI	GGTGA	8 cut(s)	16, 319, 371, 515, 551, 563, 707, 1178
Hpy166II	GTNNAC	1 cut(s)	542
Hpy188I	TCNGA	5 cut(s)	91, 107, 232, 237, 1000
Hpy188III	TCNNGA	1 cut(s)	836
Hpy8I	GTNNAC	1 cut(s)	542
Hpy99I	CGWCG	3 cut(s)	44, 50, 984
HpyAV	CCTTC	5 cut(s)	214, 237, 922, 1157, 1182
HpyCH4V	TGCA	8 cut(s)	142, 522, 714, 750, 870, 876, 1013, 1027
HpyF10VI	GCNNNNNNNGC	6 cut(s)	415, 519, 607, 711, 882, 1145
HpyF3I	CTNAG	2 cut(s)	1006, 1184
Hsp92II	CATG	4 cut(s)	413, 605, 799, 1031
Kzo9I	GATC	5 cut(s)	117, 232, 490, 682, 816
LmnI	GCTCC	4 cut(s)	133, 307, 904, 1194
Lsp1109I	GCAGC	3 cut(s)	86, 734, 1126
LweI	GCATC	2 cut(s)	129, 1093
MaeI	CTAG	1 cut(s)	285
MaeIII	GTNAC	3 cut(s)	755, 944, 1118
MalI	GATC	5 cut(s)	119, 234, 492, 684, 818
MbiI	CCGCTC	1 cut(s)	136
MboI	GATC	5 cut(s)	117, 232, 490, 682, 816
MboII	GAAGA	9 cut(s)	24, 304, 339, 349, 482, 674, 1064, 1088, 1097
MhlI	GDGCHC	2 cut(s)	909, 1199
MlyI	GAGTC	2 cut(s)	289, 353
Mph1103I	ATGCAT	1 cut(s)	1029
MroXI	GAANNNNTTC	1 cut(s)	1089
MseI	TTAA	5 cut(s)	366, 498, 558, 690, 1064
MspI	CCGG	4 cut(s)	57, 305, 494, 686
MvnI	CGCG	1 cut(s)	207
MwoI	GCNNNNNNNGC	6 cut(s)	415, 519, 607, 711, 882, 1145
NdeI	CATATG	1 cut(s)	533
NdeII	GATC	5 cut(s)	117, 232, 490, 682, 816
NlaIII	CATG	4 cut(s)	413, 605, 799, 1031
NlaIV	GGNNCC	4 cut(s)	25, 225, 303, 906
NmuCI	GTSAC	1 cut(s)	755
NsiI	ATGCAT	1 cut(s)	1029
PaqCI	CACCTGC	1 cut(s)	513
PcsI	WCGNNNNNNNCGW	1 cut(s)	988
PdmI	GAANNNNTTC	1 cut(s)	1089
PfeI	GAWTC	2 cut(s)	1019, 1154
PflFI	GACNNNGTC	1 cut(s)	761
PkrI	GCNGC	7 cut(s)	37, 76, 79, 196, 209, 749, 1141
PleI	GAGTC	2 cut(s)	289, 352
PpsI	GAGTC	2 cut(s)	289, 352
PpuMI	RGGWCCY	2 cut(s)	23, 223
PshBI	ATTAAT	2 cut(s)	366, 558
Psp5II	RGGWCCY	2 cut(s)	23, 223
PspFI	CCCAGC	3 cut(s)	148, 268, 1148
PspN4I	GGNNCC	4 cut(s)	25, 225, 303, 906
PspPI	GGNCC	4 cut(s)	23, 223, 327, 763
PspPPI	RGGWCCY	2 cut(s)	23, 223
PstI	CTGCAG	1 cut(s)	878
PstNI	CAGNNNCTG	1 cut(s)	148
PsyI	GACNNNGTC	1 cut(s)	761
SaqAI	TTAA	5 cut(s)	366, 498, 558, 690, 1064
SatI	GCNGC	7 cut(s)	36, 75, 78, 195, 208, 748, 1140
Sau3AI	GATC	5 cut(s)	117, 232, 490, 682, 816
Sau96I	GGNCC	4 cut(s)	23, 223, 327, 763
SchI	GAGTC	2 cut(s)	289, 353
SduI	GDGCHC	2 cut(s)	909, 1199
SfaNI	GCATC	2 cut(s)	129, 1093
SfcI	CTRYAG	1 cut(s)	874
SinI	GGWCC	3 cut(s)	23, 223, 763
SmlI	CTYRAG	1 cut(s)	176
SmoI	CTYRAG	1 cut(s)	176
SspMI	CTAG	1 cut(s)	285
StyI	CCWWGG	1 cut(s)	766
TaqI	TCGA	2 cut(s)	159, 819
TauI	GCSGC	4 cut(s)	38, 80, 197, 210
TfiI	GAWTC	2 cut(s)	1019, 1154
Tru1I	TTAA	5 cut(s)	366, 498, 558, 690, 1064
Tru9I	TTAA	5 cut(s)	366, 498, 558, 690, 1064
TscAI	CASTG	2 cut(s)	916, 1100
TseFI	GTSAC	1 cut(s)	755
TseI	GCWGC	3 cut(s)	74, 747, 1139
Tsp45I	GTSAC	1 cut(s)	755
TspDTI	ATGAA	4 cut(s)	66, 426, 618, 1052
TspGWI	ACGGA	2 cut(s)	130, 204
TspRI	CASTG	2 cut(s)	916, 1100
Tth111I	GACNNNGTC	1 cut(s)	761
VpaK11BI	GGWCC	3 cut(s)	23, 223, 763
VspI	ATTAAT	2 cut(s)	366, 558
XmnI	GAANNNNTTC	1 cut(s)	1089
XspI	CTAG	1 cut(s)	285
Zsp2I	ATGCAT	1 cut(s)	1029

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.